Clone Read LE_HBa0024G05_T7_135070

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0024G05_T7_135070
Primer
T7
ID from Seq. Facility
LE_HBa_024_G05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
727 trimmed for vector and quality, 971 raw
Genbank Accession
Sequence
>LE_HBa0024G05_T7_135070 (raw untrimmed)
TGAACTGGGGTACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACATACCTCTAAGGGATTAACCCCTTGATTAAATTCCGCAAGAATCT
CGACGAACGCTTGGTCCTCTCCTCTTTTCTCTACTTGAACTTTCAACCAAAATCATAGGTGTATATTAGGATTATAAAACTGAACCTATAGCATTACACC
CCTAAAATATTAATAAAAATTAATTAAATCTGATTTGGTAAGGAAGCAAAGTACCTTTACTATTTTCGGCTAACTTTTCTTAACTGGACAACCTAATTTC
AGTAGGTCATATCTCCCTCATCCGAACTCGAAGCTTAGCAAACTCTGTGACGTTGAAAAGACAAGTCAAAGAGATTTCCTAAGGTATCTTGTAGCACATA
TAAATCATCCTTTTCTAGGAGTTATAGTAGTTTGAAGTTGACCCAAAACTTATACTTGAGCATAACTTCAGATTTCGCTCTTTCTTATTTCTTCCAAAAA
TCTCACTCACTACGAAGAACGGTTCCAGTCTTGGTTCAAAAAATTTCTGGGGTGTTACACTAATGAGTTGGAAAATCTCATGTATATTCACACAATTTTT
TATTTTTCATTTTCGCATTTATAAGTCCTATTTAAAAAATTGCCCAAATTTCCAAATTTTCGTATGGATTAATTGATCCGACGCGTGGAGCCCCAATTAT
TTTCTTTGAAAAACTTTATTAGGAGCTCTGTAATGAGTTATGGAACCTTGACGTAAAATCACACAATATTTGAATGTCTATTTTAATCATTTACAAGCCT
TTTTTAAGATCGCCTAATTTCACGTTTTTTCGTGTGATTAGCCCCATGGATCTGATGCCGGGAACCCCAAAAATTTCTCAAAAACGTATTATGTACATCA
CTCAAAATTTAAATCCTTCTGTTTACCCCCTTTTTTAAAACCATTAAGACTTCAAGTTCCTTTTAAAAAAC
>LE_HBa0024G05_T7_135070 (trimmed for quality and cloning vector)
AGCTTACATACCTCTAAGGGATTAACCCCTTGATTAAATTCCGCAAGAATCTCGACGAACGCTTGGTCCTCTCCTCTTTTCTCTACTTGAACTTTCAACC
AAAATCATAGGTGTATATTAGGATTATAAAACTGAACCTATAGCATTACACCCCTAAAATATTAATAAAAATTAATTAAATCTGATTTGGTAAGGAAGCA
AAGTACCTTTACTATTTTCGGCTAACTTTTCTTAACTGGACAACCTAATTTCAGTAGGTCATATCTCCCTCATCCGAACTCGAAGCTTAGCAAACTCTGT
GACGTTGAAAAGACAAGTCAAAGAGATTTCCTAAGGTATCTTGTAGCACATATAAATCATCCTTTTCTAGGAGTTATAGTAGTTTGAAGTTGACCCAAAA
CTTATACTTGAGCATAACTTCAGATTTCGCTCTTTCTTATTTCTTCCAAAAATCTCACTCACTACGAAGAACGGTTCCAGTCTTGGTTCAAAAAATTTCT
GGGGTGTTACACTAATGAGTTGGAAAATCTCATGTATATTCACACAATTTTTTATTTTTCATTTTCGCATTTATAAGTCCTATTTAAAAAATTGCCCAAA
TTTCCAAATTTTCGTATGGATTAATTGATCCGACGCGTGGAGCCCCAATTATTTTCTTTGAAAAACTTTATTAGGAGCTCTGTAATGAGTTATGGAACCT
TGACGTAAAATCACACAATATTTGAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953883
Expected error %
1.1508
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0024G05
Clone
Clone name
hba-24g5
LE_HBa0024G05
C04HBa0024G05
P024G05
Clone type
BAC
Contamination
none
Estimated length
86,866
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found