Clone Read LE_HBa0024J09_SP6_135221

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0024J09_SP6_135221
Primer
SP6
ID from Seq. Facility
LE_HBa_024_J09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
585 trimmed for vector and quality, 937 raw
Genbank Accession
Sequence
>LE_HBa0024J09_SP6_135221 (raw untrimmed)
TAGATTTGATTAATGTTTGATCTTTGTCGGGGTTCTTATAAAACACCCATTTTTATGGTAACAAGTACTTCCTTACAATGGTATTTCTACTTAAACGTAA
GTTTAATATGTCTATTTCTCTTAAACTATTTATGCACTATGTTAGGACTCAATTAGGGAGAAATGTTAAGGCATTAAGGTTTGACAATGGGACTGAGTCT
GCTAAGTATGTGCCCACTGCATTGTTCAAAGAGTTGGGAATCATACACGAGAGGTCTTGTCTATATACCCTTATCAAAATGGGGTTGTTTAGAGAAAACA
TAGACATATACTTGAGTAACTAGGGCACTCAAGTTGTATGCACACATTCCTTTGATGTTTTGGGGGGCACTATGTCTTAGTTGTAGTTTATCTAATCAAC
ATATTATCAAGTAGTGTGATAGGACATCAAACTACTTCTGGGAAGTTATTATATGGAAACTAACCAGGTCTGTCTCATTTAAGGACATTAGGGTTCTTGT
GCATTGCTAAGAATCTTACTAGACATGTTAAACTGATGGCAATATCAAGGCCAGTTCTTCATATTGGAATATTCAGAAGCTAGAATGGATACGTTCTTTT
TTAACTGATCAATAGGACCTTATTTGTAAGAAGAGATGTTCATCTTTAGGGAAACAATTCCTATTTTTACAGAAACCAGCCATCTTACCAAAAAATCCTA
TATAGAATATGTGGAAAACAAATTTTTTTACTTCATTCAAATACAATTTTTTACAACGGAGTGACCTACCATCTTTCCTGCAAGGGGATAAAGGCTTGCT
CTTGAAAAGAAGTTTCGACAATTACTTTAGTAAAACTTAAGAATTTTTAAGGCATATTCTAAAATTAATTTTTTATTTTCATACTCTGTCTCCCTCCCTT
TCCCCCAAATTGATCCAAGGCGCCTTTTAAACTGTCC
>LE_HBa0024J09_SP6_135221 (trimmed for quality and cloning vector)
GGGGTTCTTATAAAACACCCATTTTTATGGTAACAAGTACTTCCTTACAATGGTATTTCTACTTAAACGTAAGTTTAATATGTCTATTTCTCTTAAACTA
TTTATGCACTATGTTAGGACTCAATTAGGGAGAAATGTTAAGGCATTAAGGTTTGACAATGGGACTGAGTCTGCTAAGTATGTGCCCACTGCATTGTTCA
AAGAGTTGGGAATCATACACGAGAGGTCTTGTCTATATACCCTTATCAAAATGGGGTTGTTTAGAGAAAACATAGACATATACTTGAGTAACTAGGGCAC
TCAAGTTGTATGCACACATTCCTTTGATGTTTTGGGGGGCACTATGTCTTAGTTGTAGTTTATCTAATCAACATATTATCAAGTAGTGTGATAGGACATC
AAACTACTTCTGGGAAGTTATTATATGGAAACTAACCAGGTCTGTCTCATTTAAGGACATTAGGGTTCTTGTGCATTGCTAAGAATCTTACTAGACATGT
TAAACTGATGGCAATATCAAGGCCAGTTCTTCATATTGGAATATTCAGAAGCTAGAATGGATACGTTCTTTTTTAACTGATCAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946995
Expected error %
0.5403
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 52 E Value 6e-11 Identity 32.50% Align. Length 454bp (77.61%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0024J09
Clone
Clone name
hba-24j9
LE_HBa0024J09
P024J09
Clone type
BAC
Contamination
none
Estimated length
115,671
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found