Clone Read LE_HBa0024J09_T7_135222

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0024J09_T7_135222
Primer
T7
ID from Seq. Facility
LE_HBa_024_J09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
764 trimmed for vector and quality, 1000 raw
Genbank Accession
Sequence
>LE_HBa0024J09_T7_135222 (raw untrimmed)
GGAAGACAGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCCAGTGTGTTGATATTCTCCATTTTGTGGTTCATAAGAACTGT
CAGGTCCAAGGGAACAACCCTTTATAAAAAAGGACATTTTTTAGAATATCTAAAAATACAGTGAACAACTCTCAACCTTCTTTTCTCCTTTGCTTCACTT
AGTATTATTTGGAGCTCAGTAAGCTTCTCTGTATGAGCCTATTATAAAAATAGATCAAAAATATATCAAGTTACAGAGTTTATAGTAATACTAAATATAT
GATTATAATTACTAACTGAAGGAGACCCCCTTTCTAAGTATTTCGCTATTAGAGTGACATATTTTAGGCATTTTTAAGTTTGCACAGTCAACACTAGTGT
GGAAACATCAAACCTTACCTCAACGCTAAAGCACATTGACCAATCATCAGCATCGTAAAAACACCCAACAAAAATAACAAGAATTATTCAATAATGTAGA
AAAGTACATACAACAAAGAAATAGATCAACAGAAAAGAACTCGAGAAAAGTAGAGTGTCATACATAGAAATCTTTTCAACCATTCCTCTTTAAGATTTTT
ATTGAACTAGACTCTGCATCAAATGCTGCAAAATAAAGGTCATGTTAAGGTCAAATGAAACTCCAAATATTAGTAAAAGATGTGTAAAATTTAGTACCTC
TTCATCTCGATTTGGAATGGATCTTCAGCAATAAAAAATAGCATTTGAGTTATTCAATTGAATGAAATCGGGGAAGTCCAATTCATGAATTTAACATATT
AAAAAAAATATACTGGTCGATTCAGTTCATCAAGTTGGTTCATTTCTTGATCATAAAATCTTCAAAACTGAGCGAATAAAAGAAATTACATCTATTTTTG
AATCTAAATGAAACAAGAAACTTTCAACATAATTATCATCTCAAAAACCCTTTACCTTTTTCCTTAAAAAAGCGGGCCTTTCCCCTTTTGGAAAAACTTA

>LE_HBa0024J09_T7_135222 (trimmed for quality and cloning vector)
AGCTTCTTCCAGTGTGTTGATATTCTCCATTTTGTGGTTCATAAGAACTGTCAGGTCCAAGGGAACAACCCTTTATAAAAAAGGACATTTTTTAGAATAT
CTAAAAATACAGTGAACAACTCTCAACCTTCTTTTCTCCTTTGCTTCACTTAGTATTATTTGGAGCTCAGTAAGCTTCTCTGTATGAGCCTATTATAAAA
ATAGATCAAAAATATATCAAGTTACAGAGTTTATAGTAATACTAAATATATGATTATAATTACTAACTGAAGGAGACCCCCTTTCTAAGTATTTCGCTAT
TAGAGTGACATATTTTAGGCATTTTTAAGTTTGCACAGTCAACACTAGTGTGGAAACATCAAACCTTACCTCAACGCTAAAGCACATTGACCAATCATCA
GCATCGTAAAAACACCCAACAAAAATAACAAGAATTATTCAATAATGTAGAAAAGTACATACAACAAAGAAATAGATCAACAGAAAAGAACTCGAGAAAA
GTAGAGTGTCATACATAGAAATCTTTTCAACCATTCCTCTTTAAGATTTTTATTGAACTAGACTCTGCATCAAATGCTGCAAAATAAAGGTCATGTTAAG
GTCAAATGAAACTCCAAATATTAGTAAAAGATGTGTAAAATTTAGTACCTCTTCATCTCGATTTGGAATGGATCTTCAGCAATAAAAAATAGCATTTGAG
TTATTCAATTGAATGAAATCGGGGAAGTCCAATTCATGAATTTAACATATTAAAAAAAATATAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.934437
Expected error %
1.2148
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0024J09
Clone
Clone name
hba-24j9
LE_HBa0024J09
P024J09
Clone type
BAC
Contamination
none
Estimated length
115,671
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found