Clone Read LE_HBa0170B06_SP6_13557

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0170B06_SP6_13557
Primer
SP6
ID from Seq. Facility
LE_HBa_170_B06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
428 trimmed for vector and quality, 753 raw
Genbank Accession
Sequence
>LE_HBa0170B06_SP6_13557 (raw untrimmed)
CCCCCTTTTGGTCATTTCCTNCCCTTCTCCTATTTTTGGCGTCTCATACTCCCCCTTTTCGTTCTTGAACCCTACAATTCAGAAGAAAGTTAAGCTTCTT
ATTACATTCAAAGATGGTGGTTCCGTGCGTTGCCGAGCTTTCCGATCCTGTCAATGATGCGATGGTCCCGAGGCGTTGCAGTGCGAGAATAAAAAAATTG
AAGAGTGAGCAGGAAGCTCAGCGTGAGCGTGAGAGTCAGAGAGTACGGTGCCGCTCCAATGACGACTCAGTTCTTGGGAAGAAAACCAAGGTTTATAAGA
AGAGCAAGCTTGTTACTCCCTCACAAGCTCAAACTCAAGCTCCTAATAATGACGTCACAGTTGCCACTGTTGATAACGATGACGTCACTATAACCAATGT
TGGTGCCCGAATTGACTGTACCGATCATCCTGACCCCGAAAACTCTCTGAATCCCCAGCTTAGCGGGAACGGGACTGAAAAAAGTTCGCATGCCAGGGTG
ACAGAGACTCTGCTGATATTTAACAAGCATTATCTCCATGTCGTTTAGGTTTCCTCAATTTCCCATTTCTTTTTTTCGTGATAATTTCCGCAAGCAGACA
TTTCATTAAGAAAGAGAGGGTTCCATCTTTAAAGCATATCTTTGTCACATGTGTATTTGCAAGTAATTATTTTCTTTCATGTTCAACGTGCTTTGGAAAT
GGAGAACATATTTTGGCTTTCTTTTACTTTATTTTTCATTATCTCAATCTACT
>LE_HBa0170B06_SP6_13557 (trimmed for quality and cloning vector)
GTTCTTGAACCCTACAATTCAGAAGAAAGTTAAGCTTCTTATTACATTCAAAGATGGTGGTTCCGTGCGTTGCCGAGCTTTCCGATCCTGTCAATGATGC
GATGGTCCCGAGGCGTTGCAGTGCGAGAATAAAAAAATTGAAGAGTGAGCAGGAAGCTCAGCGTGAGCGTGAGAGTCAGAGAGTACGGTGCCGCTCCAAT
GACGACTCAGTTCTTGGGAAGAAAACCAAGGTTTATAAGAAGAGCAAGCTTGTTACTCCCTCACAAGCTCAAACTCAAGCTCCTAATAATGACGTCACAG
TTGCCACTGTTGATAACGATGACGTCACTATAACCAATGTTGGTGCCCGAATTGACTGTACCGATCATCCTGACCCCGAAAACTCTCTGAATCCCCAGCT
TAGCGGGAACGGGACTGAAAAAAGTTCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976835
Expected error %
0.25416
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0170B06
Clone
Clone name
hba-170b6
LE_HBa0170B06
C03HBa0170B06
P170B06
Clone type
BAC
Contamination
none
Estimated length
96,646
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found