Clone Read LE_HBa0170B06_T7_13559

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0170B06_T7_13559
Primer
T7
ID from Seq. Facility
LE_HBa_170_B06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
681 trimmed for vector and quality, 785 raw
Genbank Accession
Sequence
>LE_HBa0170B06_T7_13559 (raw untrimmed)
NCTGGGTCCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCCTCCAAAGCTTTCCTCCCCCGTTATGAAATAGACCTGACAGCATTCTG
CTTCATAGCCTCCTGCAATTAAGGCTTTGGAAAATTTATTCAATGTGGCTACGATTTCCTCAGAGTAGCCTGGAAATTTATTTTCTTCAGAAGGTTTAGA
TTCAGAAGCAGTGTCTTGTTCTGCATCTTCATTGGTGTCTGATGATGAAGAATTAGGGTTAGGCTTGGCAGAAGAAGTGTCTAAATTGGTGATATCTGAA
TCAGTATTGATCTTGTAATCGTAGAGGATTGACTTGTATTCTTCCTCTATGTAGGACATTGCTCGTTGAAGAACACCATCGACGCGGCTGATTGAATAAG
CATATTTGTACTCTGAAGAAAATCGACAGAGGGAGGTAAATAGCTTGGAGATTCGATCTACAATATTTAAAAATGATGTGGCTTCCTCCTGAGCTAGCTG
GCTCCATTTGACGGGTGCATCACCGCCATCATATTCATCAATTTTCGCTTCAACAAGAACAGCAAATTGTTCTACAAACACAGGAACATCGGGAGGCTTA
GATTCATCATCATCCCCTTTAAAGTTTGATGATTCAGAGATAAATTGATCTATTTCTTCTGAAACCTTATCGAGATCAGGAGGCAGGGGAGAAGAAAACT
TCAACCTTGACCCCTTCGTCGTCTTCAGGTTTGATATCGCCTGGCTTGGCACCCTCCCCCTCTGTTGTGTTGATGACTCAATCGT
>LE_HBa0170B06_T7_13559 (trimmed for quality and cloning vector)
AGCTTTCCTCCAAAGCTTTCCTCCCCCGTTATGAAATAGACCTGACAGCATTCTGCTTCATAGCCTCCTGCAATTAAGGCTTTGGAAAATTTATTCAATG
TGGCTACGATTTCCTCAGAGTAGCCTGGAAATTTATTTTCTTCAGAAGGTTTAGATTCAGAAGCAGTGTCTTGTTCTGCATCTTCATTGGTGTCTGATGA
TGAAGAATTAGGGTTAGGCTTGGCAGAAGAAGTGTCTAAATTGGTGATATCTGAATCAGTATTGATCTTGTAATCGTAGAGGATTGACTTGTATTCTTCC
TCTATGTAGGACATTGCTCGTTGAAGAACACCATCGACGCGGCTGATTGAATAAGCATATTTGTACTCTGAAGAAAATCGACAGAGGGAGGTAAATAGCT
TGGAGATTCGATCTACAATATTTAAAAATGATGTGGCTTCCTCCTGAGCTAGCTGGCTCCATTTGACGGGTGCATCACCGCCATCATATTCATCAATTTT
CGCTTCAACAAGAACAGCAAATTGTTCTACAAACACAGGAACATCGGGAGGCTTAGATTCATCATCATCCCCTTTAAAGTTTGATGATTCAGAGATAAAT
TGATCTATTTCTTCTGAAACCTTATCGAGATCAGGAGGCAGGGGAGAAGAAAACTTCAACCTTGACCCCTTCGTCGTCTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974262
Expected error %
0.717037
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g13990.1 Score 95 E Value 3e-20 Identity 11.20% Align. Length 599bp (87.96%) Frame 1
68418.m01636 exocyst subunit EXO70 family protein contains Pfam domain PF03081: Exo70 exocyst complex subunit;
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g13150.1 Score 67 E Value 9e-12 Identity 9.20% Align. Length 617bp (90.60%) Frame 1
68418.m01506 exocyst subunit EXO70 family protein leucine zipper-containing protein - Lycopersicon esculentum, EMBL:Z12127 contains Pfam domain PF03081: Exo70 exocyst complex subunit;
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP04133.1| Score 95 E Value 1e-18 Identity 11.20% Align. Length 599bp (87.96%) Frame 1
putative leucine zipper protein [Arabidopsis thaliana] dbj|BAB11127.1| leucine zipper protein-like [Arabidopsis thaliana] gb|AAO41913.1| putative leucine zipper protein [Arabidopsis thaliana] ref|NP_196903.1| exocyst subunit EXO70 family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX96482.1| Score 74 E Value 3e-12 Identity 9.70% Align. Length 605bp (88.84%) Frame 1
hypothetical protein LOC_Os11g06700 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0170B06
Clone
Clone name
hba-170b6
LE_HBa0170B06
C03HBa0170B06
P170B06
Clone type
BAC
Contamination
none
Estimated length
96,646
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found