Clone Read LE_HBa0025B07_T7_135602

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025B07_T7_135602
Primer
T7
ID from Seq. Facility
LE_HBa_025_B07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
814 trimmed for vector and quality, 965 raw
Genbank Accession
Sequence
>LE_HBa0025B07_T7_135602 (raw untrimmed)
GCTCACCCGGGACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTTCATGCTGATATAATACACCATTAAGAAGTGGAAGATAAAAATA
GAAAGTAAAATAAGTTCTACTATGTTAATAGGACTCAATGGATTTTCACACTTCCACTTAGTAACAAGAAATGCAAGAAAAAAAGGGGTAATGAGGATAG
GTAGGCCATCGCTAATAGACAAACCAAGCAAGAGTTCATTGAAATCTTGAGACTGAAAAAGCTTGAGTGATGGCAAATACCTGGTACAATTTTACTTGGT
GCTTTGTTAACCATATTGTTATCATGCACTTTCTGTGAGGATGATTGAAACTTTGGTGGCGGCGGCGGTGGAGGCATCATTCTAGGAGGTGGCGGCGGCA
GCATTGAACTGGATAAGGGCTGAACCAACTTTCTGGGAGTCGGAATACCAATTTTGTCTGTATCACCTTTCTCTGAAATTCGTTCCTGAAGCATTAGAAG
CTCCGTAGCCTGCAGTGGATTCTGTCAACCAGAAGGGGGAGGGGGAGTCCATCCAGAAAACTTAGAAATTCCAGGAAAAAAGGAGGTAAAAGTTTTGAGT
TTTTCGAGAACATTCTTTTACTTGTATAGTAGCAGGCAAGGGAAGTTCAAAATAAATGCATGATCATAAGAGTTATTGGTTGACATGAATAAATTGGACT
CAATCGTGTAAGATGCAGCTTGACTTTTTTTTCTCTCACTTGTTACAAGGAGCTTAGATCAACATGTTTAGAAAATGCATATATTGCAGATACCAATAGA
AAACATTTTATCTTCTAGAGTAAAGTTGAAACAGTTTGAAAGCCTCACAGGCAGAATGTACTGTGAGCTCGATCTCATAACCCTTTTAGTACTTGAAGCA
AAGTGGATTAAAATGGGCATTTCATATTAGCATATTACCTTTAACAAATGCCTAAACCAAAGGGC
>LE_HBa0025B07_T7_135602 (trimmed for quality and cloning vector)
AGCTTATTTCATGCTGATATAATACACCATTAAGAAGTGGAAGATAAAAATAGAAAGTAAAATAAGTTCTACTATGTTAATAGGACTCAATGGATTTTCA
CACTTCCACTTAGTAACAAGAAATGCAAGAAAAAAAGGGGTAATGAGGATAGGTAGGCCATCGCTAATAGACAAACCAAGCAAGAGTTCATTGAAATCTT
GAGACTGAAAAAGCTTGAGTGATGGCAAATACCTGGTACAATTTTACTTGGTGCTTTGTTAACCATATTGTTATCATGCACTTTCTGTGAGGATGATTGA
AACTTTGGTGGCGGCGGCGGTGGAGGCATCATTCTAGGAGGTGGCGGCGGCAGCATTGAACTGGATAAGGGCTGAACCAACTTTCTGGGAGTCGGAATAC
CAATTTTGTCTGTATCACCTTTCTCTGAAATTCGTTCCTGAAGCATTAGAAGCTCCGTAGCCTGCAGTGGATTCTGTCAACCAGAAGGGGGAGGGGGAGT
CCATCCAGAAAACTTAGAAATTCCAGGAAAAAAGGAGGTAAAAGTTTTGAGTTTTTCGAGAACATTCTTTTACTTGTATAGTAGCAGGCAAGGGAAGTTC
AAAATAAATGCATGATCATAAGAGTTATTGGTTGACATGAATAAATTGGACTCAATCGTGTAAGATGCAGCTTGACTTTTTTTTCTCTCACTTGTTACAA
GGAGCTTAGATCAACATGTTTAGAAAATGCATATATTGCAGATACCAATAGAAAACATTTTATCTTCTAGAGTAAAGTTGAAACAGTTTGAAAGCCTCAC
AGGCAGAATGTACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962555
Expected error %
0.6429
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025B07
Clone
Clone name
hba-25b7
LE_HBa0025B07
C02HBa0025B07
P025B07
Clone type
BAC
Contamination
none
Estimated length
108,096
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found