Clone Read LE_HBa0025F04_SP6_135787

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025F04_SP6_135787
Primer
SP6
ID from Seq. Facility
LE_HBa_025_F04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
738 trimmed for vector and quality, 968 raw
Genbank Accession
Sequence
>LE_HBa0025F04_SP6_135787 (raw untrimmed)
TAAAATCTCGGAAAAACATTTAAAAGAACTNNTCCAAGTCATTTAGTTTTCGGTATGTGATAAAATAATTGTAGCAAGAAATTTTTATTTTATTTAAGTT
GAGGTCTATCAAAAATATAATTTTTATTTTATTTAAGTTTAAGGTTTATCAAAAATAAATATTTTATTTTATTTAATTTTGAGGTCTATTAAAAATAAAA
ATTTTATTGTTATGAGATGATAGTAAGATATATATCATCTTTTTCAAAATTCACTTTTATTATTACACTAAATATATTATCGTTAGATCAAAAATTACTT
TGATAGGAACTAAATGCGATACCTCCCTTTTCTTTTATTCTCATTGTGTTAATTATCTTTTTTACATGTTTATTCCATATATAGCAATAAGAAAAGTCGA
TCTTATGTTATATTCTTATGATCGATCTTTTCTTAATTGAGACATATAAATTTCATTCGTGCTATAATTCTAGCTCCAGTAATAAAGGTTTTAGTAAAAC
GTTAATTCTCTTAATATTATGACGTTCAATAATTATAGTCCAATTTTTTATTTAGTACTTTTTTTAAATAATTTTCAGAGAATTTCATCTCAAAATTTAC
ATATCTTGAAAATCGTGGCGATGAAACTTTAAATTTTGAATTCACTTCTGAATGGAAATGATCCGATTCTCAAATATAACCATGAAAAATAATAATTGCT
AGTTAAATGAAACTATTCAAAGTAATTTTTTTAGATTAAGAGAGAAAACATATCTTCAAATTTAAAGATTATCATTCTTTACCTCATAAAAAAAACTTTT
TAAAATTTTAATCATACTAATCGAATATTACCATGTCATTCGTTACCTCATATCATCTTCTTAACGAACTGATAATATCATCATATTCGCCCACACAAAG
TAAAAAAAGAAAAAGACAAATGATTCCCCGTAGGTGTAATAAAAATCATCCGTCTACTTTGTCCTCTC
>LE_HBa0025F04_SP6_135787 (trimmed for quality and cloning vector)
CAAGTCATTTAGTTTTCGGTATGTGATAAAATAATTGTAGCAAGAAATTTTTATTTTATTTAAGTTGAGGTCTATCAAAAATATAATTTTTATTTTATTT
AAGTTTAAGGTTTATCAAAAATAAATATTTTATTTTATTTAATTTTGAGGTCTATTAAAAATAAAAATTTTATTGTTATGAGATGATAGTAAGATATATA
TCATCTTTTTCAAAATTCACTTTTATTATTACACTAAATATATTATCGTTAGATCAAAAATTACTTTGATAGGAACTAAATGCGATACCTCCCTTTTCTT
TTATTCTCATTGTGTTAATTATCTTTTTTACATGTTTATTCCATATATAGCAATAAGAAAAGTCGATCTTATGTTATATTCTTATGATCGATCTTTTCTT
AATTGAGACATATAAATTTCATTCGTGCTATAATTCTAGCTCCAGTAATAAAGGTTTTAGTAAAACGTTAATTCTCTTAATATTATGACGTTCAATAATT
ATAGTCCAATTTTTTATTTAGTACTTTTTTTAAATAATTTTCAGAGAATTTCATCTCAAAATTTACATATCTTGAAAATCGTGGCGATGAAACTTTAAAT
TTTGAATTCACTTCTGAATGGAAATGATCCGATTCTCAAATATAACCATGAAAAATAATAATTGCTAGTTAAATGAAACTATTCAAAGTAATTTTTTTAG
ATTAAGAGAGAAAACATATCTTCAAATTTAAAGATTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.865005
Expected error %
0.0841
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025F04
Clone
Clone name
hba-25f4
LE_HBa0025F04
P025F04
Clone type
BAC
Contamination
none
Estimated length
120,686
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found