Clone Read LE_HBa0025H01_SP6_135877

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025H01_SP6_135877
Primer
SP6
ID from Seq. Facility
LE_HBa_025_H01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
752 trimmed for vector and quality, 939 raw
Genbank Accession
Sequence
>LE_HBa0025H01_SP6_135877 (raw untrimmed)
AATTAATAAAAACATAGTTGTGGTGCGAAATTTCGAATAAATCGCTTATGATCAATTTTCGTGAAGGTTCTTCATTTATGGTTGGAAGAGCTGTGACATC
TGTTTTTTGGGGAGCAGTGGCTGATCGATATGGACGAAAACCAGTTATAGTTTTCGGCACTTTTGCAGTGTAAGACTAATCCTTATTTCTGTTTTACATT
TTATTCACTTAAATGTCAACAAGTTTAATTGTGCTTCTTCAGGGTTGTTTTCAACACTCTCTTTGGTCTTAGTGTCAACTTTTGGATGGCAATTGCTACG
CGATTTCTACTTGGTTTTTTAAATGGTTTGATTGGACCAATAAAGGTATTCGACTGATGAAGAATTCAGTACTGTATCCTCAGCTATTCTTTTAAGATAA
GCTTATATACCTTCCATGATTAGGCATATGCTGCAGAAATCTTCCGTGAAGAATATCAAGCACTGGGAATGTCAACGGTAATATGTTATGCAAATGATTT
ATAACAAACGAAAGGAATGCATTTCTGAATGATTTTTATGTTTGAGTTGTTTCAGATTAGTACTGCTTGGGGTATTGGATTGATTATTGGTCCATCTTTA
GGAGGCTTCCTTGCTCAGGTACTTTCCTTTGCGTAGCTATGTCCTTAATTTTCTACTATTTCATTTAGCATGTATGCTCTAAATGTCCGCTTTTTAATTC
AGCCTGCAGAGGAATATCCGACTGTATTCTCAAAGGATTCTATATTTGGGAGGTATTTCTGCGCGACTTCTTTCTTTTCATAATTGTGCATCTTTTCTTA
TGTTGCTTGAATTGCTATTCGACTCCAACATATGATACTTCTCTGCAGATTTCCCTAATTCTTGCCCTGCTTAGGTATATCACTGGTTTCCTTGGCGGGG
GGATGGCTTCATTTGGCTCCCGGGAAAGTACCCAATAAA
>LE_HBa0025H01_SP6_135877 (trimmed for quality and cloning vector)
CGAATAAATCGCTTATGATCAATTTTCGTGAAGGTTCTTCATTTATGGTTGGAAGAGCTGTGACATCTGTTTTTTGGGGAGCAGTGGCTGATCGATATGG
ACGAAAACCAGTTATAGTTTTCGGCACTTTTGCAGTGTAAGACTAATCCTTATTTCTGTTTTACATTTTATTCACTTAAATGTCAACAAGTTTAATTGTG
CTTCTTCAGGGTTGTTTTCAACACTCTCTTTGGTCTTAGTGTCAACTTTTGGATGGCAATTGCTACGCGATTTCTACTTGGTTTTTTAAATGGTTTGATT
GGACCAATAAAGGTATTCGACTGATGAAGAATTCAGTACTGTATCCTCAGCTATTCTTTTAAGATAAGCTTATATACCTTCCATGATTAGGCATATGCTG
CAGAAATCTTCCGTGAAGAATATCAAGCACTGGGAATGTCAACGGTAATATGTTATGCAAATGATTTATAACAAACGAAAGGAATGCATTTCTGAATGAT
TTTTATGTTTGAGTTGTTTCAGATTAGTACTGCTTGGGGTATTGGATTGATTATTGGTCCATCTTTAGGAGGCTTCCTTGCTCAGGTACTTTCCTTTGCG
TAGCTATGTCCTTAATTTTCTACTATTTCATTTAGCATGTATGCTCTAAATGTCCGCTTTTTAATTCAGCCTGCAGAGGAATATCCGACTGTATTCTCAA
AGGATTCTATATTTGGGAGGTATTTCTGCGCGACTTCTTTCTTTTCATAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952628
Expected error %
0.391
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g13750.1 Score 82 E Value 7e-27 Identity 35.10% Align. Length 690bp (91.76%) Frame 1
68418.m01600 transporter-related
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g13750.2 Score 82 E Value 4e-25 Identity 35.10% Align. Length 678bp (90.16%) Frame 1
68418.m01601 transporter-related
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM26717.1| Score 82 E Value 3e-25 Identity 35.10% Align. Length 690bp (91.76%) Frame 1
AT5g13750/MXE10_2 [Arabidopsis thaliana] gb|AAL32945.1| transporter-like protein [Arabidopsis thaliana] ref|NP_851036.1| transporter-related [Arabidopsis thaliana] gb|AAK62597.1| AT5g13750/MXE10_2 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB10596.1| Score 82 E Value 3e-25 Identity 35.10% Align. Length 690bp (91.76%) Frame 1
transporter-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025H01
Clone
Clone name
hba-25h1
LE_HBa0025H01
P025H01
Clone type
BAC
Contamination
none
Estimated length
131,823
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found