Clone Read LE_HBa0025H01_T7_135878

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025H01_T7_135878
Primer
T7
ID from Seq. Facility
LE_HBa_025_H01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
769 trimmed for vector and quality, 930 raw
Genbank Accession
Sequence
>LE_HBa0025H01_T7_135878 (raw untrimmed)
GGTGAAACTGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGTCTTCCACTTCCATGGACCTTTACAGATCTAACGTGTTGTCAT
CAGGTTCTGCTTTTGCTTCCACAACCTGTGAACTTAAGCTTTGAACTGTCTTGCATGAATGATTGCATACCAGGACACCAAGAAATTGACCTTTGGTAGA
CACCCATTCTTCAGCAGCCTTGTGGACAATATCTTTCCGAACAACATCTTCAGTATCTTCTGCTGGTCCAGGCAATTCAATAGGATTTTCTATATTCCAA
TGAGGTTCTGTATCCCATCTTGGTTCTGCGTCCCAAATTGGCCCCGGGTCTGACATTGTTGATGAGATATCCTCTTTATCATTTGTAGTTGTATTTGCCC
AAGAAGATCTAGTGAGGTCATTTGCAGCAGTCAACCCAGCCCACCCTTTATCTGTTTTTGATTTGGACCTAGTCCTGGGCCAATTCGGTGTTACTGAATG
TGGAACCTGAGGGTGGATAACTTCCGGTTCAGAAGTTGTGTTGCCACTTCGTCCAGCAGACAAGCGCTTAGATTTTGCATCAATTGCACGCACATATTCT
GATGGCTCAGTGCTACTACATGTAGTATCCAAGTCTGCTCCAGACATTCTGCTTGGGGTCATTATTGAATCAATACTTGATAAGCTTGAGGCTCTGGGAA
GCCCTTCCTTGCTTGACCTTCTCATAATGTCTGTATACAGTTCAGACATATCAATGACTGAAGCTTTTCCTTCTCCAGTTGCTTCTTTCAGTGCTGGAAG
ATACTCCACTTCAAAATTGTACTTTGGTAACACATGAATTTGAGGAACCCAGCGACAAAGTAGCGCATGGGACCAAACCGCTTTTGGTATTTCTAGATAG
TTCCCGCCCTTCAATGAAAAATGGAGTCAC
>LE_HBa0025H01_T7_135878 (trimmed for quality and cloning vector)
AGCTTCAGTCTTCCACTTCCATGGACCTTTACAGATCTAACGTGTTGTCATCAGGTTCTGCTTTTGCTTCCACAACCTGTGAACTTAAGCTTTGAACTGT
CTTGCATGAATGATTGCATACCAGGACACCAAGAAATTGACCTTTGGTAGACACCCATTCTTCAGCAGCCTTGTGGACAATATCTTTCCGAACAACATCT
TCAGTATCTTCTGCTGGTCCAGGCAATTCAATAGGATTTTCTATATTCCAATGAGGTTCTGTATCCCATCTTGGTTCTGCGTCCCAAATTGGCCCCGGGT
CTGACATTGTTGATGAGATATCCTCTTTATCATTTGTAGTTGTATTTGCCCAAGAAGATCTAGTGAGGTCATTTGCAGCAGTCAACCCAGCCCACCCTTT
ATCTGTTTTTGATTTGGACCTAGTCCTGGGCCAATTCGGTGTTACTGAATGTGGAACCTGAGGGTGGATAACTTCCGGTTCAGAAGTTGTGTTGCCACTT
CGTCCAGCAGACAAGCGCTTAGATTTTGCATCAATTGCACGCACATATTCTGATGGCTCAGTGCTACTACATGTAGTATCCAAGTCTGCTCCAGACATTC
TGCTTGGGGTCATTATTGAATCAATACTTGATAAGCTTGAGGCTCTGGGAAGCCCTTCCTTGCTTGACCTTCTCATAATGTCTGTATACAGTTCAGACAT
ATCAATGACTGAAGCTTTTCCTTCTCCAGTTGCTTCTTTCAGTGCTGGAAGATACTCCACTTCAAAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970996
Expected error %
0.5475
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g23450.2 Score 295 E Value 1e-80 Identity 21.40% Align. Length 737bp (95.84%) Frame 3
68418.m02752 diacylglycerol kinase family protein contains INTERPRO domain, IPR001206, DAG-kinase catalytic domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g23450.1 Score 295 E Value 1e-80 Identity 21.40% Align. Length 737bp (95.84%) Frame 3
68418.m02751 diacylglycerol kinase family protein contains INTERPRO domain, IPR001206, DAG-kinase catalytic domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD86587.1| Score 340 E Value 2e-92 Identity 23.30% Align. Length 737bp (95.84%) Frame 3
sphingosine kinase [Lotus corniculatus var. japonicus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB09561.1| Score 295 E Value 7e-79 Identity 21.40% Align. Length 737bp (95.84%) Frame 3
unnamed protein product [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025H01
Clone
Clone name
hba-25h1
LE_HBa0025H01
P025H01
Clone type
BAC
Contamination
none
Estimated length
131,823
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found