Clone Read LE_HBa0025I17_T7_135958

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025I17_T7_135958
Primer
T7
ID from Seq. Facility
LE_HBa_025_I17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
623 trimmed for vector and quality, 976 raw
Genbank Accession
Sequence
>LE_HBa0025I17_T7_135958 (raw untrimmed)
GGAGAAAAAGGGACCCGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGGTAGATAATAAGAAATCATCTATTGTGTTCTGTCTTGGTTAGAT
TTAACCCCTGGGCTCCAAGTGTAAAAATTTATACATATATATACCCAAAGTGTTAACATCTTCTTTTAAATCCCTTTGTTATAAACATGCTCTCTTTCAG
CCTAACTTGTCTCACCGGCTTTCTTTCATATCACATACAGGAAAAGAGCAAGTAATAGAGAAAAGAATGAAAAGTAACAGCAGAATGTGCTTCTTGCTTG
TTGCCCTTCATCTTCTTAATCTACTGACGCAAAGTCAAAGTCTAAGATCAGATTTGACAAAAGCTGATATAAACCAGATTCCATCTTCACACCCCCGGTA
CATTGTCATGTCAAATCAACACATTGCTTTTGATAAAACTTCTAACATTGTTTAAGGCAGCTAAAAAGAGTCTGATGGAGAGAAATAAGCACATTTCTTA
CACCCCTAAGACACTTTGGCATAAAAAGGGAAGTTGTTATTAGAAAAATATCCAATACTAGTTTGCATGTTGATACGCTTCCACGTGAATGAAGCACACT
TTTGTATGTTGGATAAGTACAAAGGTGAAAGACAACTATTGACTAGGGGATCAAGTGGGTGGCAACCCTGTATACAGTATGAACGCAAGACACAGCCACA
TAAGCATTTATAGAAACTAAACAGCAAAGAAATTATACAAATCTGGAAACAATAAAAATAATGAGAGAAGAAAAATGTGACAAATCATTTTCTATTCAAT
TTGCGCCATATAAAATATTCTAAAGTCTCACTGCTATTGAATGGTAGAACCCCAGGCTATTTCTTGTTCAAAGTAATCTCAAAATCCCTCCCAAAACTTT
TCTTCCCCGAATTCAAGTAAACCAATTAGCTTATTTTTCTATATTACACTTCTCTGAAAAAAAAAATTTATAAAAT
>LE_HBa0025I17_T7_135958 (trimmed for quality and cloning vector)
AGCTTAGGTAGATAATAAGAAATCATCTATTGTGTTCTGTCTTGGTTAGATTTAACCCCTGGGCTCCAAGTGTAAAAATTTATACATATATATACCCAAA
GTGTTAACATCTTCTTTTAAATCCCTTTGTTATAAACATGCTCTCTTTCAGCCTAACTTGTCTCACCGGCTTTCTTTCATATCACATACAGGAAAAGAGC
AAGTAATAGAGAAAAGAATGAAAAGTAACAGCAGAATGTGCTTCTTGCTTGTTGCCCTTCATCTTCTTAATCTACTGACGCAAAGTCAAAGTCTAAGATC
AGATTTGACAAAAGCTGATATAAACCAGATTCCATCTTCACACCCCCGGTACATTGTCATGTCAAATCAACACATTGCTTTTGATAAAACTTCTAACATT
GTTTAAGGCAGCTAAAAAGAGTCTGATGGAGAGAAATAAGCACATTTCTTACACCCCTAAGACACTTTGGCATAAAAAGGGAAGTTGTTATTAGAAAAAT
ATCCAATACTAGTTTGCATGTTGATACGCTTCCACGTGAATGAAGCACACTTTTGTATGTTGGATAAGTACAAAGGTGAAAGACAACTATTGACTAGGGG
ATCAAGTGGGTGGCAACCCTGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.956024
Expected error %
0.3956
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025I17
Clone
Clone name
hba-25i17
LE_HBa0025I17
C08HBa0025I17
P025I17
Clone type
BAC
Contamination
none
Estimated length
125,499
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found