Clone Read LE_HBa0025M21_SP6_136157

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025M21_SP6_136157
Primer
SP6
ID from Seq. Facility
LE_HBa_025_M21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
707 trimmed for vector and quality, 928 raw
Genbank Accession
Sequence
>LE_HBa0025M21_SP6_136157 (raw untrimmed)
CTTTTCGCCATGCGCGCCGTTAGGAAANGAAGTGTTAACGTTTAACAATACTGCACTTTCCGATAATCTATTACCGGCGATGGAAAATGTTTACGCCGCT
CTTGTTAGTATGAACTTAGATAAACAAGTGAGTGTTACTACTGCACATTCAGTTGCCATTCTCGAGACTTCGTACCCGCCGTCTTCCGGAGCTTTCCGTC
GAGATCTTGTTAGTTGTGTTACTCAGGTGGTGGATTTCCATTGTAAAACTGGTTCGCCGTTTCTAATCAATGCTTATCCTTATTTTGCGTATAAGGCAGA
TCCAAAGCAGGTGCAGCTCGATTTCGTGTTGTTTCAGCCTAATCAGGGGATTGTTGATCCAGTAACCAATCTTCATTACGATAACATGCTTTTCGCTCAA
ATCGATGCGGTTCATTCTGCTTTAGCTTCAATTGGCTACAAAAATGTCTGCGTACAGATCTCGGAGACAGGTTGGCCGTCGAAAGGAGACGCTGATGAGC
TCGGAGCTACGCCGGATAATGCGAGGAAATATAATTGCAATCTTATTAAACTTGTGAGTCAGAAGAAAGGAACTCCGTTGAAGCCAAACAGCAATTTGAA
TATATACGTCTTTGCTTTGTTTAACGAGAACTTGAAACCTGGCCCTATGTCGGAGCGTAACTACGGCCTGTTCAAGCCGGACGGTACACCGTCTTATCCT
TTAGGATTCTCCGGAATCAACTCCGGCGGCAGCACCAATAGCAGCTCCGGTAATAAACCTGCAACTGGTGGTGGTTCTTCAACACCGGCATCGTGGTCCC
ACAGGACGGAAGTTCCTCTTCCGGCTATATGTCCTTACTTCTAATTGGGTAGCCTACCTTTAGTAGTTTTACTTTTTTTTTTTTAACAATTTTTTAAATC
ATTCTAACCGCCCTACCAAGCCGGGCCT
>LE_HBa0025M21_SP6_136157 (trimmed for quality and cloning vector)
TAACGTTTAACAATACTGCACTTTCCGATAATCTATTACCGGCGATGGAAAATGTTTACGCCGCTCTTGTTAGTATGAACTTAGATAAACAAGTGAGTGT
TACTACTGCACATTCAGTTGCCATTCTCGAGACTTCGTACCCGCCGTCTTCCGGAGCTTTCCGTCGAGATCTTGTTAGTTGTGTTACTCAGGTGGTGGAT
TTCCATTGTAAAACTGGTTCGCCGTTTCTAATCAATGCTTATCCTTATTTTGCGTATAAGGCAGATCCAAAGCAGGTGCAGCTCGATTTCGTGTTGTTTC
AGCCTAATCAGGGGATTGTTGATCCAGTAACCAATCTTCATTACGATAACATGCTTTTCGCTCAAATCGATGCGGTTCATTCTGCTTTAGCTTCAATTGG
CTACAAAAATGTCTGCGTACAGATCTCGGAGACAGGTTGGCCGTCGAAAGGAGACGCTGATGAGCTCGGAGCTACGCCGGATAATGCGAGGAAATATAAT
TGCAATCTTATTAAACTTGTGAGTCAGAAGAAAGGAACTCCGTTGAAGCCAAACAGCAATTTGAATATATACGTCTTTGCTTTGTTTAACGAGAACTTGA
AACCTGGCCCTATGTCGGAGCGTAACTACGGCCTGTTCAAGCCGGACGGTACACCGTCTTATCCTTTAGGATTCTCCGGAATCAACTCCGGCGGCAGCAC
CAATAGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.990281
Expected error %
0.1077
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g32860.1 Score 325 E Value 2e-89 Identity 22.50% Align. Length 698bp (98.73%) Frame 1
68414.m04049 glycosyl hydrolase family 17 protein similar to beta-1,3-glucanase precursor GI:4097948 from [Oryza sativa]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42100.1 Score 305 E Value 2e-83 Identity 21.30% Align. Length 704bp (99.58%) Frame 1
68418.m05125 glycosyl hydrolase family 17 protein similar to beta-1,3-glucanase precursor GI:4097948 from [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||S31196 Score 410 E Value 1e-113 Identity 27.70% Align. Length 704bp (99.58%) Frame 1
hypothetical protein - potato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15367.1| Score 325 E Value 9e-88 Identity 22.50% Align. Length 698bp (98.73%) Frame 1
putative beta-1,3-glucanase precursor, putative [Arabidopsis thaliana] gb|AAM53268.1| putative beta-1,3-glucanase precursor, putative [Arabidopsis thaliana] ref|NP_174563.2| glycosyl hydrolase family 17 protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025M21
Clone
Clone name
hba-25m21
LE_HBa0025M21
C12HBa0025M21
P025M21
Clone type
BAC
Contamination
none
Estimated length
82,100
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found