Clone Read LE_HBa0025M21_T7_136158

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025M21_T7_136158
Primer
T7
ID from Seq. Facility
LE_HBa_025_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 923 raw
Genbank Accession
Sequence
>LE_HBa0025M21_T7_136158 (raw untrimmed)
CGGAAAATGGGCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAACAAGACATTCCTTTGTTTCTTTGATTTCTCATTCTATTGCTTTT
GTATTTGATTCCATGCTCGATATTCATAAATGGATTTAGTATAATTTTCATGTTTGAATTTAGGGAAAAGGGTCTGATATACCCTTCAACTTTGTCATTT
GGAGCTGATACACCCCTCGTTATAAAAGTGGCTCATATATACCCTTACCGTTATACAAACGGCTCACATATATCCCTGCCGTTACAAAATGGCTCACATA
TATCCTTCATTTAACGGAATTTTAAATAATTAGTTTTAAATTTATATTTATTACTTATAATATTTTTTAAAAAATTATTTAGTGGTATATATGATTCTTC
TATAAAAGTTCAAGGTATATTTTAATTTTTTTCATACATAAATTTTTTTTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTCTTATTTTATTTTTT
TCTTTCATTCCTTAGTTTAAAGAGAAAAAAATCAAACTATTTTTTTGTGTGTATTGTAATTTAATTTCGTATTCGAAAAAAATTTGGTCATCTACAATAA
GTTTTACAAGAATATTAGTGAAACATAAATAAATTTGATTATCAAAATAATAATTATAAATTAGTCATTGAAACAAAAAAAAAAAGTCAAAAAAAATATG
TTTGACGAAGATTAAATTTAAATTTTACTCATATTGAGATTATATTTTTTAGAAGAAAATAATAAAAAATTTAGATTGAAAATTATTATTTTTTCATTTC
CGTTAAAGGAAAAGGGAATTTGTTAGCCCATTCCTTTACTAGTAGGGGTTTTTTTGATTACCTCTCTTATAAGGGGTTTTAAGCTTCTAAAGACAAACTT
GATGGCTATTCAAACCATTTTCC
>LE_HBa0025M21_T7_136158 (trimmed for quality and cloning vector)
TAGAGTCGACCTGCAGGCATGCAAGCTTGAACAAGACATTCCTTTGTTTCTTTGATTTCTCATTCTATTGCTTTTGTATTTGATTCCATGCTCGATATTC
ATAAATGGATTTAGTATAATTTTCATGTTTGAATTTAGGGAAAAGGGTCTGATATACCCTTCAACTTTGTCATTTGGAGCTGATACACCCCTCGTTATAA
AAGTGGCTCATATATACCCTTACCGTTATACAAACGGCTCACATATATCCCTGCCGTTACAAAATGGCTCACATATATCCTTCATTTAACGGAATTTTAA
ATAATTAGTTTTAAATTTATATTTATTACTTATAATATTTTTTAAAAAATTATTTAGTGGTATATATGATTCTTCTATAAAAGTTCAAGGTATATTTTAA
TTTTTTTCATACATAAATTTTTTTTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTCTTATTTTATTTTTTTCTTTCATTCCTTAGTTTAAAGAGA
AAAAAATCAAACTATTTTTTTGTGTGTATTGTAATTTAATTTCGTATTCGAAAAAAATTTGGTCATCTACAATAAGTTTTACAAGAATATTAGTGAAACA
TAAATAAATTTGATTATCAAAATAATAATTATAAATTAGTCATTGAAACAAAAAAAAAAAGTCAAAAAAAATATGTTTGACGAAGATTAAATTTAAATTT
T

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.885571
Expected error %
0.2025
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025M21
Clone
Clone name
hba-25m21
LE_HBa0025M21
C12HBa0025M21
P025M21
Clone type
BAC
Contamination
none
Estimated length
82,100
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found