Clone Read LE_HBa0025N22_SP6_136207

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025N22_SP6_136207
Primer
SP6
ID from Seq. Facility
LE_HBa_025_N22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
726 trimmed for vector and quality, 939 raw
Genbank Accession
Sequence
>LE_HBa0025N22_SP6_136207 (raw untrimmed)
CTTGTTGGCCTAAGTTAGTTTGTTTGCCCTATCTTTTAGCTCATCTATACTAAAACCAAAAGATCATGTCTATTCACATGCCTCGTTTAATCAAGAAATC
TGTTATATCTGGAGATGTTCCCAAAGGCCATTTTGTTGTATATGTAGGGGAGAATCATAAGAAGAGATATGTGATCCCGATGTCATTCTTGAGCCAACGT
TTATTCCAAGAGTTGCTCAGTCAAGCTGAGGAGAATTTGGCTTTGATCATCCAATGGGTGGTCTCACAATTCCCTGCAGAGAGGACGCGTTCATCAACCT
TACTTCTCGTTTAAGGAACTGAAAAAGAAAACTTTCTTAACAGTCTGTAGAGTAGTAAAGCAGGATACACAATCTGTATAGAGAATACAATTTTGATGTT
AGACTAGGTAGACTTAGTGAAACTTTAACTCCACAAAGACTGATTGTTAGTACATGTCAAAAGGACAAATGACATATTTGTTTCTACTACAAGTTCTTTG
AAATTTTGAATTAATGATGGTTCTATTCGGTTAATATTTAATTTTTTTGTCCTTGTAATTCTCTAATCCTCTCATTGAATATTGGTTTTGAAGTTTAATG
TGTTGCTAATCATAATGAGCCAAAATCAACTTTAAAATGGCCCAAACTGGTCACATTTTCAGGTTAGTTAAAGATGTGCAGAATTTAAATTTTATATGGA
ACTATGCTGCTGTTAGCATGCTATGGTTACTCTAGCTCAAATGTACAAGCGCTAAAGCTTTTGGCAAGCCAAGTCCCACTGAGTGTAATAGAGAAACCAA
TGATGTGATAAAGTGTATGGGACAGAGATCCCTCATCCGAGTTGATTTACCTAAATCAATAGGCGTGCCATAAGAAGGTATTGTTACTTAAGGAGATTTC
TTCAAATTCCTTTTGAATTAACAAAAAACTGCTGGCGCA
>LE_HBa0025N22_SP6_136207 (trimmed for quality and cloning vector)
CTCATCTATACTAAAACCAAAAGATCATGTCTATTCACATGCCTCGTTTAATCAAGAAATCTGTTATATCTGGAGATGTTCCCAAAGGCCATTTTGTTGT
ATATGTAGGGGAGAATCATAAGAAGAGATATGTGATCCCGATGTCATTCTTGAGCCAACGTTTATTCCAAGAGTTGCTCAGTCAAGCTGAGGAGAATTTG
GCTTTGATCATCCAATGGGTGGTCTCACAATTCCCTGCAGAGAGGACGCGTTCATCAACCTTACTTCTCGTTTAAGGAACTGAAAAAGAAAACTTTCTTA
ACAGTCTGTAGAGTAGTAAAGCAGGATACACAATCTGTATAGAGAATACAATTTTGATGTTAGACTAGGTAGACTTAGTGAAACTTTAACTCCACAAAGA
CTGATTGTTAGTACATGTCAAAAGGACAAATGACATATTTGTTTCTACTACAAGTTCTTTGAAATTTTGAATTAATGATGGTTCTATTCGGTTAATATTT
AATTTTTTTGTCCTTGTAATTCTCTAATCCTCTCATTGAATATTGGTTTTGAAGTTTAATGTGTTGCTAATCATAATGAGCCAAAATCAACTTTAAAATG
GCCCAAACTGGTCACATTTTCAGGTTAGTTAAAGATGTGCAGAATTTAAATTTTATATGGAACTATGCTGCTGTTAGCATGCTATGGTTACTCTAGCTCA
AATGTACAAGCGCTAAAGCTTTTGGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958748
Expected error %
0.0536
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g75580.1 Score 56 E Value 3e-14 Identity 70.00% Align. Length 202bp (27.82%) Frame 1
68414.m08782 auxin-responsive protein, putative similar to auxin-induced protein TGSAUR22 (GI:10185820) [Tulipa gesneriana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g34760.1 Score 55 E Value 2e-13 Identity 65.00% Align. Length 202bp (27.82%) Frame 1
68417.m04934 auxin-responsive family protein auxin-induced protein X15, Glycine max, PIR2:JQ1097
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM12778.1| Score 79 E Value 4e-23 Identity 67.90% Align. Length 250bp (34.44%) Frame 1
auxin-induced SAUR-like protein [Capsicum annuum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM12777.1| Score 76 E Value 1e-12 Identity 23.30% Align. Length 149bp (20.52%) Frame 1
putative auxin-induced SAUR-like protein [Capsicum annuum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025N22
Clone
Clone name
hba-25n22
LE_HBa0025N22
C01HBa0025N22
P025N22
Clone type
BAC
Contamination
none
Estimated length
88,365
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found