Clone Read LE_HBa0025N22_T7_136208

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0025N22_T7_136208
Primer
T7
ID from Seq. Facility
LE_HBa_025_N22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
830 trimmed for vector and quality, 937 raw
Genbank Accession
Sequence
>LE_HBa0025N22_T7_136208 (raw untrimmed)
CACTAACCTGGGTCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAGTCAATGCTTACATGAAGTCCTGAAACCAATAATAGAACAATG
TTATGGAAATGAGACTCAGTGGCAGAGACGCAGAGTCAGAGATTTTTTAAAGGGTGTCCAAAAATATCAACTTGTTATGTTAAGAATGTCAAAATCAGGT
TACTTGTATACATGCTATTCTTTTTCTGATACTGTGAAATAGTAAGACAGATAACATGACATGCATTGAAATGAAATTAGAGAGAACCTGATAGAGCATG
AATAGTGTTAATATTATTCTCCTTGCAGTCAGCACATTCTCCAAAACCAACCACCTTAATTGTGTTGTCATCAGCAATGCAGAAAGTAGAGAGTAGTAAA
GACAGGGACAGTCCCAGAAGGACTCTGCCACAAAGGGACTGAAGCCCCATTCTGTTTATACAAAATAAATGTAAGTTTTGTATGATACTCTTGAATGTGT
TCCTCTCAACTAACTAGAGGGTATATTTATAGTAATTGTTTGCTTACCATAAAGTAAAGAAAAACTTTGTTTTTATGACCGGCTCACCGGCACGTAATTA
AGGTCCTCACATGAGTTTAGGTCCCATGGTCTTGAATTTTTATGAATGACAGAAAGATTATAAAATTGAAAGGTGATTTTTGTAAAATAAAAATAAAAAA
ATTATTGAGGAATGGGTGGTCACAGAGCTGTTTGATAAAATGACATTATCATCATTCAATGAGGTCTCCAACTGTACATAAAAATGCCTTTTTTTCTATC
TGTTAACCTACTTTGTTAGCTCCTCATTAATGTCACTTATTTTACTGAATTATATGTGAAACTTTGACTACTTTTTTGAAACTTAAACTGTTAATAATGA
AATGATTGCCATTCTTTCCATTAAATTGAATACAAGG
>LE_HBa0025N22_T7_136208 (trimmed for quality and cloning vector)
AGCTTGCAGTCAATGCTTACATGAAGTCCTGAAACCAATAATAGAACAATGTTATGGAAATGAGACTCAGTGGCAGAGACGCAGAGTCAGAGATTTTTTA
AAGGGTGTCCAAAAATATCAACTTGTTATGTTAAGAATGTCAAAATCAGGTTACTTGTATACATGCTATTCTTTTTCTGATACTGTGAAATAGTAAGACA
GATAACATGACATGCATTGAAATGAAATTAGAGAGAACCTGATAGAGCATGAATAGTGTTAATATTATTCTCCTTGCAGTCAGCACATTCTCCAAAACCA
ACCACCTTAATTGTGTTGTCATCAGCAATGCAGAAAGTAGAGAGTAGTAAAGACAGGGACAGTCCCAGAAGGACTCTGCCACAAAGGGACTGAAGCCCCA
TTCTGTTTATACAAAATAAATGTAAGTTTTGTATGATACTCTTGAATGTGTTCCTCTCAACTAACTAGAGGGTATATTTATAGTAATTGTTTGCTTACCA
TAAAGTAAAGAAAAACTTTGTTTTTATGACCGGCTCACCGGCACGTAATTAAGGTCCTCACATGAGTTTAGGTCCCATGGTCTTGAATTTTTATGAATGA
CAGAAAGATTATAAAATTGAAAGGTGATTTTTGTAAAATAAAAATAAAAAAATTATTGAGGAATGGGTGGTCACAGAGCTGTTTGATAAAATGACATTAT
CATCATTCAATGAGGTCTCCAACTGTACATAAAAATGCCTTTTTTTCTATCTGTTAACCTACTTTGTTAGCTCCTCATTAATGTCACTTATTTTACTGAA
TTATATGTGAAACTTTGACTACTTTTTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948701
Expected error %
0.806
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA04449.1| Score 89 E Value 1e-16 Identity 26.10% Align. Length 164bp (19.76%) Frame 1
proline-rich protein [Solanum tuberosum] pir||T07598 proline-rich protein GPP1 - potato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0025N22
Clone
Clone name
hba-25n22
LE_HBa0025N22
C01HBa0025N22
P025N22
Clone type
BAC
Contamination
none
Estimated length
88,365
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found