Clone Read LE_HBa0026C23_T7_136450

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026C23_T7_136450
Primer
T7
ID from Seq. Facility
LE_HBa_026_C23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
860 trimmed for vector and quality, 908 raw
Sequence
>LE_HBa0026C23_T7_136450 (raw untrimmed)
GCTAACCTGGGACCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCACACATATTATTATCTATACCATCAGACTTGACTTCACAATTAAA
ATACACCTTACACCACTATTCTTTATCATAGTAAATTAGGTCATCCACTATACCTGTACCTCCAGTACCTAGTTTAGACAACTCGTGCAGATTTTCTCTG
AATTCAACTTCAAAAGTACTTCTAGCACACTTGCATAACTGATTTTTCCTTTGCAGCCCTCTCCAATTCTTTGACCGATTTGCTAGTATATGCCTAGCAC
ACATTCTTTCCTCACAAGCTGGCAACAACTCCTTTATAGCTATATCCAGTCCCTAACAGTTACAACAAACATTAGATAATTAAGTTTAAAAAAGGGATAA
ACCAACAAATAATTTAAAACAAGTTTACCTTTTGCATGTCTGACATAATTGTGAAACTTGTTCCATCTCCTAATCTCAAGTCTTCTTTCAACAGAGAAAT
AAACCAACTCCAAGTGATTGTGTTCTCATTTTCAACTACAGCCCAAGCAAGTGGAAGCATTTGATTATTGCCATCTTTAGCCACTGCAATAAGTAATTGA
CCCCTGCAAACCCCCTTCAAGAAACAACCATCCAGACCGATGCATTTTCTAGCTGACATAAATGCCATCTTGAGTGCAACAAAACAAATATAAAATGCCT
CAAATACTGGCCTACCAGATTCATTAGCTTCTCCTAGCTTCACCACACAAGTACTCCCAGGATTAGTCCTCAGCAACTCATCCTTATAATCAAGAATTCT
CCCAAATTCCTTAACATGATCACCCATAAGTTTCATCAAATTTTACCTCTTGCTTTTCTAGTTGTGGTCTTACAACATGCACTTATACTTCTTACGGATT
ACTCTTGC
>LE_HBa0026C23_T7_136450 (trimmed for quality and cloning vector)
AGCTTTCACACATATTATTATCTATACCATCAGACTTGACTTCACAATTAAAATACACCTTACACCACTATTCTTTATCATAGTAAATTAGGTCATCCAC
TATACCTGTACCTCCAGTACCTAGTTTAGACAACTCGTGCAGATTTTCTCTGAATTCAACTTCAAAAGTACTTCTAGCACACTTGCATAACTGATTTTTC
CTTTGCAGCCCTCTCCAATTCTTTGACCGATTTGCTAGTATATGCCTAGCACACATTCTTTCCTCACAAGCTGGCAACAACTCCTTTATAGCTATATCCA
GTCCCTAACAGTTACAACAAACATTAGATAATTAAGTTTAAAAAAGGGATAAACCAACAAATAATTTAAAACAAGTTTACCTTTTGCATGTCTGACATAA
TTGTGAAACTTGTTCCATCTCCTAATCTCAAGTCTTCTTTCAACAGAGAAATAAACCAACTCCAAGTGATTGTGTTCTCATTTTCAACTACAGCCCAAGC
AAGTGGAAGCATTTGATTATTGCCATCTTTAGCCACTGCAATAAGTAATTGACCCCTGCAAACCCCCTTCAAGAAACAACCATCCAGACCGATGCATTTT
CTAGCTGACATAAATGCCATCTTGAGTGCAACAAAACAAATATAAAATGCCTCAAATACTGGCCTACCAGATTCATTAGCTTCTCCTAGCTTCACCACAC
AAGTACTCCCAGGATTAGTCCTCAGCAACTCATCCTTATAATCAAGAATTCTCCCAAATTCCTTAACATGATCACCCATAAGTTTCATCAAATTTTACCT
CTTGCTTTTCTAGTTGTGGTCTTACAACATGCACTTATACTTCTTACGGATTACTCTTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.938552
Expected error %
0.767
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g14570.1 Score 78 E Value 2e-18 Identity 46.20% Align. Length 438bp (50.93%) Frame 3
68415.m01632 SWIM zinc finger family protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAW28576.1| Score 148 E Value 2e-48 Identity 50.40% Align. Length 633bp (73.60%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE03261.1| Score 144 E Value 2e-35 Identity 49.60% Align. Length 579bp (67.33%) Frame 3
OSJNBa0011J08.16 [Oryza sativa (japonica cultivar-group)] ref|XP_473620.1| OSJNBa0011J08.16 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026C23
Clone
Clone name
hba-26c23
LE_HBa0026C23
P026C23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found