Clone Read LE_HBa0026G09_T7_136614

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026G09_T7_136614
Primer
T7
ID from Seq. Facility
LE_HBa_026_G09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
588 trimmed for vector and quality, 977 raw
Sequence
>LE_HBa0026G09_T7_136614 (raw untrimmed)
GATGACCGGGGCCTGAGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGGAGAACTAGGAGGTCAGAACCCTTTAAGGGATACCTTCGCAGTGC
AGTCCACTCACAACCCCCCTATAGAGGAGATTCGTGATGAAATGGCTCAGATGAGAACTGAGCTTGGGTTGGTACTAAAACATATCACTGGCCCTGCAGA
AAAGATAAATGCAGTTAACTACTTGCCTAAACCACCACCTCCTAATGAGGAATGCTATTATGCGGAGGACTCCTATGCAGTAAATAAGCAGACATGGGGG
TTTTTGACCGAGCGCCCAAGGCTCAAATCAAGATAATTGGCACCAAGGTCAAGGAACCAAGGTCGGATCTATGGTAACTATAATCATGAGGGTCATTATG
TTCGAGATGGAAGCTACAACCGCGACAACAACTTCAACAGCGGTAACTACGGTAACAGAAATGATAGGAATGGGCCCTATGTCCCCCCTAAAAATCGTGA
ATTTACTCCTAGGAATGGTGGAGATAGTATGGCGCGAGTTGAGGATATGTTGCACAAAATGATGAGGAGGTTCGATGCTAGTGATGAGCACATTAAAGAG
TTTAAGGTGTGATTTAGCACGTATTGAGCAAAAAGTCGATACTCATGCAATATCTATTATCAGATCTAGTTGCAATTGCCCTTATTATCTGCAACGGAGA
ACACCTGTCTCCCGGCATTCTTCTTAGCCACCCTGCTCAAATTTGAAAAAATGGCTCCCACTCGTTTACCCTCACTCCCGGGGTTGAAGTCAACCAATGA
CTTACCTACGCCCGTATGGACGATAAGGATTATATTCATTACCAGGCGTACAATGCAATGATCAACCAGATAAAGTCGTTTAAATCTCAATTATATTTGT
TTGACCTTGTCTTCATCTTGAAGTTATTTCCTATTAATTTTACTGCCATGGTTGGTTTATCTTGGATTATTAAACTT
>LE_HBa0026G09_T7_136614 (trimmed for quality and cloning vector)
AGCTTGGGAGAACTAGGAGGTCAGAACCCTTTAAGGGATACCTTCGCAGTGCAGTCCACTCACAACCCCCCTATAGAGGAGATTCGTGATGAAATGGCTC
AGATGAGAACTGAGCTTGGGTTGGTACTAAAACATATCACTGGCCCTGCAGAAAAGATAAATGCAGTTAACTACTTGCCTAAACCACCACCTCCTAATGA
GGAATGCTATTATGCGGAGGACTCCTATGCAGTAAATAAGCAGACATGGGGGTTTTTGACCGAGCGCCCAAGGCTCAAATCAAGATAATTGGCACCAAGG
TCAAGGAACCAAGGTCGGATCTATGGTAACTATAATCATGAGGGTCATTATGTTCGAGATGGAAGCTACAACCGCGACAACAACTTCAACAGCGGTAACT
ACGGTAACAGAAATGATAGGAATGGGCCCTATGTCCCCCCTAAAAATCGTGAATTTACTCCTAGGAATGGTGGAGATAGTATGGCGCGAGTTGAGGATAT
GTTGCACAAAATGATGAGGAGGTTCGATGCTAGTGATGAGCACATTAAAGAGTTTAAGGTGTGATTTAGCACGTATTGAGCAAAAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.981768
Expected error %
1.4698
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 106 E Value 3e-22 Identity 19.00% Align. Length 278bp (47.28%) Frame 2
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026G09
Clone
Clone name
hba-26g9
LE_HBa0026G09
C03HBa0026G09
P026G09
Clone type
BAC
Contamination
none
Estimated length
89,535
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found