Clone Read LE_HBa0026H06_T7_136656

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026H06_T7_136656
Primer
T7
ID from Seq. Facility
LE_HBa_026_H06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
725 trimmed for vector and quality, 951 raw
Sequence
>LE_HBa0026H06_T7_136656 (raw untrimmed)
ACCAACCCGGTCCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAACATTAAGCTTTCACACTTCTTTTTATACTTGTATAAATTCTATG
AGATCACATTTTTTGTTTGTTTGTTTGTTATGCTGAAGGGAAAATTATTTTTTCATTGTGTTTAACTTGATTATAACTCAAACGTGTAACAAACGTTCTC
TGAGACTAATTTTATCATGACAATCAAATTCTTTTATCAATAATTTTTGGATTATATACCTTACATATAAAAACAAAAAATCTGAAAAACACCATTTTAA
AAATCTTTTATATAGTATTATCAGAATAAAAGAAATGCCATAAATTTCTTTATGTGATTATTTATAATATAGAAAAATACAAAGTAATTGTAATTGTACC
AATGATAGTGCAACTTATATTCTAGGGACAAAAGGAAAAAGGAATCCTACATATAAAAGGAAAAAGAACACATGTTACAAGAATATATACGATTTAAGTA
TCATTAACTGATAAATAACTATAAATAAAAAATTTAAATTTTATATATATATATATATATATATATATATATATATATATATATATATAGTATTAATGAA
GTGAAATTATTAATTTTAATGATATTAATACAATATAATATACTGATTTACTATCAGTTAAATGAAAAAATTTAAAGATATAGAATGTAATTATTTAATG
AAATATAAATATAAAGCGATATATATTTATTATTATTTTACTTTTACGGGTGATTTGTTATTTTCCTGAAAAAAGAAAGAACTTTATAATTAATATTCTT
TTTAAAAAAAAAAATTTATAGAGAACAAATGACCCGCATAAACCATTTCCTTTGGAAAGATCAAAAACACAAAAGCACTAAAAATTTTAACAAAGAAAAA
ACTACAATTTTAATATCCAAAACTTTTTAAAAACCCCAACTCTTGAAAAAA
>LE_HBa0026H06_T7_136656 (trimmed for quality and cloning vector)
AGCTTAAACATTAAGCTTTCACACTTCTTTTTATACTTGTATAAATTCTATGAGATCACATTTTTTGTTTGTTTGTTTGTTATGCTGAAGGGAAAATTAT
TTTTTCATTGTGTTTAACTTGATTATAACTCAAACGTGTAACAAACGTTCTCTGAGACTAATTTTATCATGACAATCAAATTCTTTTATCAATAATTTTT
GGATTATATACCTTACATATAAAAACAAAAAATCTGAAAAACACCATTTTAAAAATCTTTTATATAGTATTATCAGAATAAAAGAAATGCCATAAATTTC
TTTATGTGATTATTTATAATATAGAAAAATACAAAGTAATTGTAATTGTACCAATGATAGTGCAACTTATATTCTAGGGACAAAAGGAAAAAGGAATCCT
ACATATAAAAGGAAAAAGAACACATGTTACAAGAATATATACGATTTAAGTATCATTAACTGATAAATAACTATAAATAAAAAATTTAAATTTTATATAT
ATATATATATATATATATATATATATATATATATATATATAGTATTAATGAAGTGAAATTATTAATTTTAATGATATTAATACAATATAATATACTGATT
TACTATCAGTTAAATGAAAAAATTTAAAGATATAGAATGTAATTATTTAATGAAATATAAATATAAAGCGATATATATTTATTATTATTTTACTTTTACG
GGTGATTTGTTATTTTCCTGAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.84582
Expected error %
0.4403
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026H06
Clone
Clone name
hba-26h6
LE_HBa0026H06
P026H06
Clone type
BAC
Contamination
none
Estimated length
81,703
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found