Clone Read LE_HBa0026K15_SP6_136817

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026K15_SP6_136817
Primer
SP6
ID from Seq. Facility
LE_HBa_026_K15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
512 trimmed for vector and quality, 928 raw
Sequence
>LE_HBa0026K15_SP6_136817 (raw untrimmed)
TTTAATTTTTTCCTCAAAGATTAGAGGGAAGGATTCCTCTCCAACCTCCCACTTGGTTTGAGTCGGTAGACGCAAGTTCAAAAATTTGAGATTCTCAAAG
GTGTCTTCCTCCCCCATGTTCCATTCTTCTCCCTGGATGATTGTATCGTAAAGTAACAACTCTTCAAGGTTGGGAAGTCTAGCTATTGTTGATAGTGAAT
CGGATGTCAGAGGAAAGTCATACAACCACAGTTGTTTCAAATTTGAAGGGAAGTGAAAATCCCACGGCCGATTTGTCGCTACAGAGGACCCACTGTGGTT
TGTGTTTGAACTTTTAAAACTTACAGAGAGTGTTTCTAGTTCAGTTAGGCAATCCAATTTCGGGAACCAATATTGCTCTGTTGAATAATCCCATGACTCC
TTGAGTTCAAACTGAAGCACCTGAAGATTGGGAAACCTTTTGAAAATATTCTTTGTATCTTTCGAATAGGAAATCACCAGTTCCCCTAATATTCTCAAGT
TCTCTAACTTTGTGTCCTCTGCTATCAATATTGATTCATCTGCATCCTTATCAAAGAAAGAACAAGCTTCCACGAACAGTACTCACAACTTTACAAGATC
CCAAATTCTCGGTTAATATTATCAAGGTTGATTTTTTTGTTTTTCACTGACCATATTTCTTGATTCTATAGGTTTGATATTGATTTAGGTTGATTTTTTA
TTTTGTTTTCAATTCCTTTTTACTTCATAGGTTCTTATGTGCTGTTTCATTCGTTAATTATCTTTCACCTTATTTACTTGGTTCCATGTGCACATTTTTT
TATCCTTTATTTAATATGTTAATGCTTCTTACATTGTTCTCACTTTACTCCTTCTTTTTCTAATATTAACGTTTCCTTTTTTTCTTTTTTATTTTTATTC
CACTCAAATTATCTACCTACATTTTTTT
>LE_HBa0026K15_SP6_136817 (trimmed for quality and cloning vector)
GGAAGGATTCCTCTCCAACCTCCCACTTGGTTTGAGTCGGTAGACGCAAGTTCAAAAATTTGAGATTCTCAAAGGTGTCTTCCTCCCCCATGTTCCATTC
TTCTCCCTGGATGATTGTATCGTAAAGTAACAACTCTTCAAGGTTGGGAAGTCTAGCTATTGTTGATAGTGAATCGGATGTCAGAGGAAAGTCATACAAC
CACAGTTGTTTCAAATTTGAAGGGAAGTGAAAATCCCACGGCCGATTTGTCGCTACAGAGGACCCACTGTGGTTTGTGTTTGAACTTTTAAAACTTACAG
AGAGTGTTTCTAGTTCAGTTAGGCAATCCAATTTCGGGAACCAATATTGCTCTGTTGAATAATCCCATGACTCCTTGAGTTCAAACTGAAGCACCTGAAG
ATTGGGAAACCTTTTGAAAATATTCTTTGTATCTTTCGAATAGGAAATCACCAGTTCCCCTAATATTCTCAAGTTCTCTAACTTTGTGTCCTCTGCTATC
AATATTGATTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972113
Expected error %
0.3672
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC32252.1| Score 319 E Value 2e-86 Identity 30.60% Align. Length 509bp (99.41%) Frame 3
disease resistance gene homolog Mi-copy2 [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC97933.1| Score 319 E Value 2e-86 Identity 30.60% Align. Length 509bp (99.41%) Frame 3
disease resistance protein [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026K15
Clone
Clone name
hba-26k15
LE_HBa0026K15
P026K15
Clone type
BAC
Contamination
none
Estimated length
59,917
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found