Clone Read LE_HBa0026K15_T7_136818

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026K15_T7_136818
Primer
T7
ID from Seq. Facility
LE_HBa_026_K15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
728 trimmed for vector and quality, 961 raw
Sequence
>LE_HBa0026K15_T7_136818 (raw untrimmed)
GGATAACTCGGGCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTCCACCAAAAAGATTCTATCCCTTTAAGGGCATGACCATATAGA
ATATATGTATTATCTTCCCTTTTGCGCAAAGTTGATTTGGGGAATGAAACAGTATCTTTTTATTTTCATTTTTTATGATTAAAATTCTCTTCTTTTTTAG
TTATATATTAATATTCTCTTCTTTATTATTTATATTTATTAAAAATTCTCTTCCTTATTATTTATTTATTACAATTCTCTTCTTTATTATTTATTTATTA
AAATTCTTTTCTTTATATTTATTTATTAAAATTCTCTTCTTTATTATATTTATTAAAATTCTCTTCTTTATTATTTATTTATTAAAATTCTTTTCTTTAT
ATTTATTAATTAAAATTCTCTTCTTTATTATTTATTTATTAAAATTCTCTTCTTTACTATTTATTTATTAAAAATCTTTTCTTTATATTTATTAAAATTC
TCTTTAGTAGAGCTGTAGTCCAGTTCTTGGAGCATCTAAATAAAGCACACCATCTTTTGAATCTTTACAATTTAGACAGAGAACTCCACTTTCATTTTTA
GATGTTCCAATTTTTTTTTCTTTTATAAATAGTGTAGCTATTAAAACCCTCTATTTCCAAGCAATCTCTTTAAAAAAAAAAATTAACAAGTTTTTTCTTG
CTATTTTTCTTCTTAATTCCTTCATCTCTTCTAGCATCAAATTTTATAACCATCGGATCGATGTTCAATTTCTGTTGAACTAAAAATCCGATGGGATACT
AAAGAGTACCTTCCAATTACCCCTTTTTTTTCAACACTTTCGTAATACCAAAATATATGTTTACCTCGTACCATCTTCCGTTGAATTTTGGGCGATCAAT
CAAAAAGGAAAAAACCCTATTTTTGAAAACTACCCCCCCCCTTTTTACTCAATTTCCCTCT
>LE_HBa0026K15_T7_136818 (trimmed for quality and cloning vector)
AGCTTTTTCCACCAAAAAGATTCTATCCCTTTAAGGGCATGACCATATAGAATATATGTATTATCTTCCCTTTTGCGCAAAGTTGATTTGGGGAATGAAA
CAGTATCTTTTTATTTTCATTTTTTATGATTAAAATTCTCTTCTTTTTTAGTTATATATTAATATTCTCTTCTTTATTATTTATATTTATTAAAAATTCT
CTTCCTTATTATTTATTTATTACAATTCTCTTCTTTATTATTTATTTATTAAAATTCTTTTCTTTATATTTATTTATTAAAATTCTCTTCTTTATTATAT
TTATTAAAATTCTCTTCTTTATTATTTATTTATTAAAATTCTTTTCTTTATATTTATTAATTAAAATTCTCTTCTTTATTATTTATTTATTAAAATTCTC
TTCTTTACTATTTATTTATTAAAAATCTTTTCTTTATATTTATTAAAATTCTCTTTAGTAGAGCTGTAGTCCAGTTCTTGGAGCATCTAAATAAAGCACA
CCATCTTTTGAATCTTTACAATTTAGACAGAGAACTCCACTTTCATTTTTAGATGTTCCAATTTTTTTTTCTTTTATAAATAGTGTAGCTATTAAAACCC
TCTATTTCCAAGCAATCTCTTTAAAAAAAAAAATTAACAAGTTTTTTCTTGCTATTTTTCTTCTTAATTCCTTCATCTCTTCTAGCATCAAATTTTATAA
CCATCGGATCGATGTTCAATTTCTGTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.830593
Expected error %
0.6507
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026K15
Clone
Clone name
hba-26k15
LE_HBa0026K15
P026K15
Clone type
BAC
Contamination
none
Estimated length
59,917
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found