Clone Read LE_HBa0026N03_SP6_136937

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026N03_SP6_136937
Primer
SP6
ID from Seq. Facility
LE_HBa_026_N03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
611 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0026N03_SP6_136937 (raw untrimmed)
AAAAAGTGCACTACACCTTTGGACTTGATGTTTTTGTTAATGCATGGTTTTTAGAACCTTTCTTCATGTTTTTTAATGGTTCCCGCACCTGTTTGGGAGA
TAACGTTCATCTTCTTGCAGTAGGTATCAGAATTGGTGCATTGTTGTAACGACCTTCATGTCTTTGAACAGGATATCTTAGCTTTCCCGCTTATTTGCCC
AGACTGGAATGCTGATGAAGAGATGTTGCTCCTTGAGGTGTTTTTTTGAGAACCCTCTTTTTTGGACACCTCGTGTCTTTCTTTATTACTGAGATTGACC
TTTAACTTTTCCCATTAAGTAATTATAACACCAATACCCCTTTTTCTTATTGTCTTGATTCCTTGAATTTGCTATGCCTAGGGAATTGAGATGTATGGCA
TGGGTAATTGGGCTGAAGTAGGTGAGCATGTCGGAACAAAGACAAAAGAAGCCTGCATTGACCATTTTAAGGATGCGTACTTAAAGTCACCTTACTTTCC
TCTACCAGTAAGAACTTATCAGAAATATTTTGCAAGTTTAATTCTTTTGACTCACCATTTCACCTGCATTTTCCTTTTCCATTTCCAGGATATGACTCAC
GTCATGGGGAAAAACAGAATGGAACTCCTTGCCATGGCTAAAGGGAATTTCACTGATAAGAAAGGTTAGGAATCTAATTCTCAATTCTAATTTCTCTAGT
TTACTTACCGTGTTGTTCCTCTTGATAGCCTGATCTTTTACCATAAAATAACGAAAATGCTTGCTGCAACTTAGGGATGGGTCTCGAGATCTAAATGTTT
GAGTAACATATCTTCGTTAAAAATTATTAGTGGTCTGGGAAATGTTTCTATCTTTCT
>LE_HBa0026N03_SP6_136937 (trimmed for quality and cloning vector)
AAAAGTGCACTACACCTTTGGACTTGATGTTTTTGTTAATGCATGGTTTTTAGAACCTTTCTTCATGTTTTTTAATGGTTCCCGCACCTGTTTGGGAGAT
AACGTTCATCTTCTTGCAGTAGGTATCAGAATTGGTGCATTGTTGTAACGACCTTCATGTCTTTGAACAGGATATCTTAGCTTTCCCGCTTATTTGCCCA
GACTGGAATGCTGATGAAGAGATGTTGCTCCTTGAGGTGTTTTTTTGAGAACCCTCTTTTTTGGACACCTCGTGTCTTTCTTTATTACTGAGATTGACCT
TTAACTTTTCCCATTAAGTAATTATAACACCAATACCCCTTTTTCTTATTGTCTTGATTCCTTGAATTTGCTATGCCTAGGGAATTGAGATGTATGGCAT
GGGTAATTGGGCTGAAGTAGGTGAGCATGTCGGAACAAAGACAAAAGAAGCCTGCATTGACCATTTTAAGGATGCGTACTTAAAGTCACCTTACTTTCCT
CTACCAGTAAGAACTTATCAGAAATATTTTGCAAGTTTAATTCTTTTGACTCACCATTTCACCTGCATTTTCCTTTTCCATTTCCAGGATATGACTCACG
TCATGGGGAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962076
Expected error %
0.2436
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g16420.1 Score 75 E Value 3e-14 Identity 22.20% Align. Length 125bp (20.46%) Frame 1
68417.m02484 transcriptional adaptor (ADA2b) identical to transcriptional adaptor ADA2b [Arabidopsis thaliana] gi|13591700|gb|AAK31320
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g16420.3 Score 75 E Value 3e-14 Identity 22.20% Align. Length 125bp (20.46%) Frame 1
68417.m02486 transcriptional adaptor (ADA2b) identical to transcriptional adaptor ADA2b [Arabidopsis thaliana] gi|13591700|gb|AAK31320
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB10418.1| Score 77 E Value 3e-13 Identity 15.60% Align. Length 230bp (37.64%) Frame 1
transcriptional adaptor like protein [Arabidopsis thaliana] emb|CAB78684.1| transcriptional adaptor like protein [Arabidopsis thaliana] pir||H71430 hypothetical protein - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_469769.1| Score 75 E Value 1e-12 Identity 24.60% Align. Length 125bp (20.46%) Frame 1
putative transcriptional adaptor [Oryza sativa (japonica cultivar-group)] gb|AAR87248.1| putative transcriptional adaptor [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026N03
Clone
Clone name
hba-26n3
LE_HBa0026N03
P026N03
Clone type
BAC
Contamination
none
Estimated length
112,642
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found