Clone Read LE_HBa0026N03_T7_136938

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026N03_T7_136938
Primer
T7
ID from Seq. Facility
LE_HBa_026_N03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 909 raw
Sequence
>LE_HBa0026N03_T7_136938 (raw untrimmed)
CTTAATATGGTCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGAAAATACTTCCCTCTAATTTTGTTTCTCTTGCTGACCTTTTAGTTA
TTCCTAAATCTTTTATATGTGTATATCGAGAAATCCTCAAAGGTGGCGCAAAATCTTGTATTATTCTCAAATCAAACCTTGACTGCTCATTATTCATGAC
TTGAATGTCATTTGACTTTCATAGATTCCTTTAACTGGACTTTTGCACCCACTATCCTTTGAAACATATGTAACATTCGCAGGTCGACCATTAGTTATCT
TGTGTTAACTCTTCCTGTTTGGTGAATTTGTAAATTGTTATTGAAAGTCCATCACTTGTGTTGCTTGCCTGCAGAACAATCAAGAAAATTTTCCTTACAT
TTTACAGTTTACCTGATTTCTCAACCCAGAATTTGTTGTGATTTTCTCTTACAGAAACAACTAGAGAGGATAATATCAGGATTTTTGGAAGTGAAAGCCA
AATTCAAGTAACACCTACGAGTGGGAAATTTGTGCCTAGTGAGAAGGTTCAAAATCTGAGAGACAAATTGATAAAGTTCATGGAGGATCACATATATCCA
AGGGAAAGTGACTTTTACAAGCTTGCACTGTCTACCATGCGCTTGGACAATTCACCCAGATGAGGAAAAGTTAAAGGATCTGGCAAAAAGAGAAGGCCTT
TGGAACTTGTGGATACCGGTGAGTTTGCAAGTTTTTTTCTGGTATAACAGATTACTCCTCAAATTTATTTTATAAAAATCTTCTCAAATATTGTTCAACT
AACATGCTGTTTGTAGTGCTGCACTGCAAATAAAATTGATCTTTGCCACTGAAATGATTCCCCTGTTTAAACCAATTCATCTTTTTTTGGTGTTGATTTT
TCAACTCTA
>LE_HBa0026N03_T7_136938 (trimmed for quality and cloning vector)
AGCTTAGAAAATACTTCCCTCTAATTTTGTTTCTCTTGCTGACCTTTTAGTTATTCCTAAATCTTTTATATGTGTATATCGAGAAATCCTCAAAGGTGGC
GCAAAATCTTGTATTATTCTCAAATCAAACCTTGACTGCTCATTATTCATGACTTGAATGTCATTTGACTTTCATAGATTCCTTTAACTGGACTTTTGCA
CCCACTATCCTTTGAAACATATGTAACATTCGCAGGTCGACCATTAGTTATCTTGTGTTAACTCTTCCTGTTTGGTGAATTTGTAAATTGTTATTGAAAG
TCCATCACTTGTGTTGCTTGCCTGCAGAACAATCAAGAAAATTTTCCTTACATTTTACAGTTTACCTGATTTCTCAACCCAGAATTTGTTGTGATTTTCT
CTTACAGAAACAACTAGAGAGGATAATATCAGGATTTTTGGAAGTGAAAGCCAAATTCAAGTAACACCTACGAGTGGGAAATTTGTGCCTAGTGAGAAGG
TTCAAAATCTGAGAGACAAATTGATAAAGTTCATGGAGGATCACATATATCCAAGGGAAAGTGACTTTTACAAGCTTGCACTGTCTACCATGCGCTTGGA
CAATTCACCCAGATGAGGAAAAGTTAAAGGATCTGGCAAAAAGAGAAGGCCTTTGGAACTTGTGGATACCGGTGAGTTTGCAAGTTTTTTTCTGGTATAA
C

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948535
Expected error %
1.0203
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_479496.1| Score 65 E Value 3e-19 Identity 70.50% Align. Length 210bp (29.96%) Frame 3
putative acyl-CoA dehydrogenase [Oryza sativa (japonica cultivar-group)] dbj|BAD31978.1| putative acyl-CoA dehydrogenase [Oryza sativa (japonica cultivar-group)] dbj|BAC83542.1| putative acyl-CoA dehydrogenase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026N03
Clone
Clone name
hba-26n3
LE_HBa0026N03
P026N03
Clone type
BAC
Contamination
none
Estimated length
112,642
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found