Clone Read LE_HBa0026N22_SP6_136975

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026N22_SP6_136975
Primer
SP6
ID from Seq. Facility
LE_HBa_026_N22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
714 trimmed for vector and quality, 913 raw
Sequence
>LE_HBa0026N22_SP6_136975 (raw untrimmed)
AAGACATAATTTGCTCTTTTCCTTTAGGCATCTTCCACCTGGANCATGCACTTAACAAGGAAAATAATCTCACCTTTGGTGAGAATAAATCATAATTCTT
ATACAAGCAACCCTTCCCAATTCCATCCAGCTTCTTTTTCATGAGGCAACTAAAATCGTTGGAACCGCAACAGAAGTCCACAATCTGCTCAACAAACAAC
AAAAACTTTAATCCAGTGCCGGCTAACAAAGGAGCTTGTCCAATCTTAGAAAGTTTACAAATCATAAATAGCACGATCCTGGCAGATTTACAACTCACAG
TATTGGGCATCAATTAATCATGTTCCAAAGTACAACAGGAGCAACACAGATGATTTGTGTTTCCCCTATTAAAGTACTAGCAAAGCAGAAAATCAACGAA
TAAAGTTGGAGAATTATAGCCACTTCACAGAATGAGAAAATTATTGTACTGAAAGTAGGTAAGAGTTCCACTCATAAAATGTAAGACCAGCACAAATTCC
TACCATATCACCATCTCGAACATACCAATGAAGCATATCGACGATCTGCAGAGTAAAATCACGCACTCAGTCAAGTAAATATACCAGGTAGAGACACTAC
AGCCTGATGAGCAGACATGAAATAAGATGCACTTAAGAGAAAACCACATAGATCATGGCCAAGGGGAAGGGAGGGAAGGTGGTGGGTTTTGAAGAAAAAC
AGGTCCAAGCACGAAAGTGGATAGGAACCAATAGCCTACTTCTCATGAAAACCCCCATTAAGTCAGTACTACTTTCTCTTACGGTGAGACAATATAATTT
ATAGCGATTCACAGTGTTTTCCATTCTTTTTTGTATTAATATCAAATAGAAATCCTGGGATGGTTCAAACCATGAACAACGAAAAATCCTTAACCATTAT
TCTTATCGCCATC
>LE_HBa0026N22_SP6_136975 (trimmed for quality and cloning vector)
TGCACTTAACAAGGAAAATAATCTCACCTTTGGTGAGAATAAATCATAATTCTTATACAAGCAACCCTTCCCAATTCCATCCAGCTTCTTTTTCATGAGG
CAACTAAAATCGTTGGAACCGCAACAGAAGTCCACAATCTGCTCAACAAACAACAAAAACTTTAATCCAGTGCCGGCTAACAAAGGAGCTTGTCCAATCT
TAGAAAGTTTACAAATCATAAATAGCACGATCCTGGCAGATTTACAACTCACAGTATTGGGCATCAATTAATCATGTTCCAAAGTACAACAGGAGCAACA
CAGATGATTTGTGTTTCCCCTATTAAAGTACTAGCAAAGCAGAAAATCAACGAATAAAGTTGGAGAATTATAGCCACTTCACAGAATGAGAAAATTATTG
TACTGAAAGTAGGTAAGAGTTCCACTCATAAAATGTAAGACCAGCACAAATTCCTACCATATCACCATCTCGAACATACCAATGAAGCATATCGACGATC
TGCAGAGTAAAATCACGCACTCAGTCAAGTAAATATACCAGGTAGAGACACTACAGCCTGATGAGCAGACATGAAATAAGATGCACTTAAGAGAAAACCA
CATAGATCATGGCCAAGGGGAAGGGAGGGAAGGTGGTGGGTTTTGAAGAAAAACAGGTCCAAGCACGAAAGTGGATAGGAACCAATAGCCTACTTCTCAT
GAAAACCCCCATTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958013
Expected error %
0.357
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g55390.1 Score 67 E Value 7e-12 Identity 24.80% Align. Length 116bp (16.25%) Frame 2
68418.m06901 hydroxyproline-rich glycoprotein family protein
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026N22
Clone
Clone name
hba-26n22
LE_HBa0026N22
P026N22
Clone type
BAC
Contamination
none
Estimated length
126,202
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found