Clone Read LE_HBa0026N22_T7_136976

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026N22_T7_136976
Primer
T7
ID from Seq. Facility
LE_HBa_026_N22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
727 trimmed for vector and quality, 911 raw
Sequence
>LE_HBa0026N22_T7_136976 (raw untrimmed)
GGGTGAAATCGGGCCGAGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGATGACAAAAATATAGGTGTAAAAACTGACCATATAGCTTTGG
ATAACACCTTCAAAGACTCTCCTAATGTCACATTCTTAGTAAATATTGCATGATAAACATGAATAGAATAAATGCTTACAGATTGCGGCATAAAGGAATT
TCAAAATTCTACTCTTCTTTACAACCAATCACCAGCATTTAGTTCGTAGGCATCTTTTAACAAGAAGTTATAAAGCAATCAACATTGGGACTTCAAAAAA
TGTGGATGACAAGTGCGTGCATTAAAGTAAACAGAACAAAAAGATGGCAAAATTAGCAATAGAAGCTCCTGACCATCTCCTCTTCTTGACGACGCCGTAG
CTCTGATTTATGCTGATGACGCAAACGTAGAAGCTCTTGTAGCCTATTTAGGTCATTCCCAAGGACAGCTTGTGCTAACTCAGGATCATTCTGCAAGTTC
AAACATCACAAGCTCATGGGACCTATGTGTTATGAGTTGATCTCAAACCAACCACAAGGTATATAGGAGGAGAACAAAGTTGATAGCATTCATGTTCACA
CCAGATTGATGCAAAAAAGTAACACAGTATAAGAGGAATCCATCAGACAGCATATGATCCCTCTCAGAATCTAACTATCCTTCACTTTGCATGTAAGATC
ACAATGAAGACATAATTAGCAATCTTTTTTTTTTTGGATAAGGAAATATAGATAATTAGCAATCATTTTTAAATCAGACTGATCCCACAAAATTACAAAG
TACGATAGAAATCCACCAAATAAACATGAAACTTCCTTTTCAGTAAAATAATTCCTTCATTGGACCTATAAGATCGGGGATAAGGTCATAATAAAAAATA
ATTTTTCCTAT
>LE_HBa0026N22_T7_136976 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGATGACAAAAATATAGGTGTAAAAACTGACCATATAGCTTTGGATAACACCTTCAAAGACTCTCCTA
ATGTCACATTCTTAGTAAATATTGCATGATAAACATGAATAGAATAAATGCTTACAGATTGCGGCATAAAGGAATTTCAAAATTCTACTCTTCTTTACAA
CCAATCACCAGCATTTAGTTCGTAGGCATCTTTTAACAAGAAGTTATAAAGCAATCAACATTGGGACTTCAAAAAATGTGGATGACAAGTGCGTGCATTA
AAGTAAACAGAACAAAAAGATGGCAAAATTAGCAATAGAAGCTCCTGACCATCTCCTCTTCTTGACGACGCCGTAGCTCTGATTTATGCTGATGACGCAA
ACGTAGAAGCTCTTGTAGCCTATTTAGGTCATTCCCAAGGACAGCTTGTGCTAACTCAGGATCATTCTGCAAGTTCAAACATCACAAGCTCATGGGACCT
ATGTGTTATGAGTTGATCTCAAACCAACCACAAGGTATATAGGAGGAGAACAAAGTTGATAGCATTCATGTTCACACCAGATTGATGCAAAAAAGTAACA
CAGTATAAGAGGAATCCATCAGACAGCATATGATCCCTCTCAGAATCTAACTATCCTTCACTTTGCATGTAAGATCACAATGAAGACATAATTAGCAATC
TTTTTTTTTTTGGATAAGGAAATATAG

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953171
Expected error %
0.0554
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|M16728.1:1-87 Score 68 E Value 1e-12 Identity 100.00% Align. Length 33bp (4.54%) Frame 2
S.aureus multiple cloning site vector upstream of beta-lactamase gene, clone pWN1818
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65333.1:1-122 Score 68 E Value 1e-12 Identity 100.00% Align. Length 33bp (4.54%) Frame 2
Cloning vector pSP73
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026N22
Clone
Clone name
hba-26n22
LE_HBa0026N22
P026N22
Clone type
BAC
Contamination
none
Estimated length
126,202
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found