Clone Read LE_HBa0026P16_SP6_137059

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026P16_SP6_137059
Primer
SP6
ID from Seq. Facility
LE_HBa_026_P16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
740 trimmed for vector and quality, 925 raw
Sequence
>LE_HBa0026P16_SP6_137059 (raw untrimmed)
GAAAGGAGGGTTTGATATATTATAATTCTGGTTTGGTTCTTTTAAGGTAAATTCTTATGATAGTCCTTTTTACTTTGTGACTTTTATTGATGACCATTGT
CGTTCTCTCTAAATATTCTTTTTGAAGTCAAAGGATTAGGTATTTGATGTGTTCAAGAAATTTCAGGCCTTGGTTGAGAGACAGACGTAGAAGAAATTGA
AATGCATTCGTTCTTGTAATGGTGGTGCTTATATTGGTCTTTTTTTTATAGATATTGTAGAGAGCAAGTTATTTTGCATTAGAAAAATCCTTCAAAGACT
CCTCGATAAAATGGTTTAGCAGAGAGGATGAACATAACTCTAGTATAGAGGGTTAGTTGTATACTTTCACATTCTTTTTTGGCAGAAACACTAAATAATG
CTGCCTATATTATCAATTATCTCCTACCATTTCTTTGAATGGTGATGTCTCTGATGGAGTTTGATCCCCGGTGAAAATGTTTCTTATGATCATCTTAAAG
TTTTTGGTCGAACGCCTTTGTGCATGTTCCTAAGGATAAGAGTTCAAAGTTGGATGATAAAAGTAGGCAATATATATTTGTTTTTTATGGTCAAGATGAA
TTCGAGTATCGTTATTTTGATCCAGTTGAGAAGAAACTTGTTAGAAGGCATGATGTTGTGTTCCTTGAAGACCAAACAATTGAAGATCTTGACAAAGATG
AAAAAGTTGATTTTGAAAGTAGTGAAAACCTAGTCAATGTTGATCCAATTCTTTTGACTATTCCACCAAGTGAAAATCTTCAAAACGATGAAATTAATTG
ATATTGAAGATTGGTGTCATATTCCAAATAACAAGATTGTCGTTGAATCTCCATGCAAAACAATGGGGTTATCTGAACCACTTTTTTTTATGCTCCAAAA
ATTTCGGCAAAAAATTACTAAAAAA
>LE_HBa0026P16_SP6_137059 (trimmed for quality and cloning vector)
TTGATATATTATAATTCTGGTTTGGTTCTTTTAAGGTAAATTCTTATGATAGTCCTTTTTACTTTGTGACTTTTATTGATGACCATTGTCGTTCTCTCTA
AATATTCTTTTTGAAGTCAAAGGATTAGGTATTTGATGTGTTCAAGAAATTTCAGGCCTTGGTTGAGAGACAGACGTAGAAGAAATTGAAATGCATTCGT
TCTTGTAATGGTGGTGCTTATATTGGTCTTTTTTTTATAGATATTGTAGAGAGCAAGTTATTTTGCATTAGAAAAATCCTTCAAAGACTCCTCGATAAAA
TGGTTTAGCAGAGAGGATGAACATAACTCTAGTATAGAGGGTTAGTTGTATACTTTCACATTCTTTTTTGGCAGAAACACTAAATAATGCTGCCTATATT
ATCAATTATCTCCTACCATTTCTTTGAATGGTGATGTCTCTGATGGAGTTTGATCCCCGGTGAAAATGTTTCTTATGATCATCTTAAAGTTTTTGGTCGA
ACGCCTTTGTGCATGTTCCTAAGGATAAGAGTTCAAAGTTGGATGATAAAAGTAGGCAATATATATTTGTTTTTTATGGTCAAGATGAATTCGAGTATCG
TTATTTTGATCCAGTTGAGAAGAAACTTGTTAGAAGGCATGATGTTGTGTTCCTTGAAGACCAAACAATTGAAGATCTTGACAAAGATGAAAAAGTTGAT
TTTGAAAGTAGTGAAAACCTAGTCAATGTTGATCCAATTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934873
Expected error %
0.505
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 124 E Value 5e-37 Identity 46.70% Align. Length 691bp (93.38%) Frame 1
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 123 E Value 4e-39 Identity 46.20% Align. Length 715bp (96.62%) Frame 1
hypothetical retrotransposon [Ipomoea batatas]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026P16
Clone
Clone name
hba-26p16
LE_HBa0026P16
C07HBa0026P16
P026P16
Clone type
BAC
Contamination
none
Estimated length
96,542
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found