Clone Read LE_HBa0027B05_SP6_137133

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027B05_SP6_137133
Primer
SP6
ID from Seq. Facility
LE_HBa_027_B05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
652 trimmed for vector and quality, 933 raw
Genbank Accession
Sequence
>LE_HBa0027B05_SP6_137133 (raw untrimmed)
GGGTGCCAAGGTAAAGATACAAACTTGNCTCCACTAGTCTCTGATATTGACTTTCGCGCCTTTTGAGTTTCCTTATTTATTTTCTAACGTAATATTCGGA
TGAATATGTGTTTCAAATGGACGACAACCTCTCATCCCTATCTCTTTTAGAAGATCTAGCACATACTTCTTTTGTGACAACATAATAAATTCTTTTGATC
TCGCTACTTCCATGCCAAAAAAATAGTTCAAATGACCCAAATCTTAGATCTCGAATTCTGAGACCAACTATTTTTTGAATCCTTCATTTCTAACAGATCT
CTTGTAAGTATGATATCATCGACATACACTATTTCGAATAGTTGTCTTCCCCTCAAGAGAATGTCAGATGACATGGTATGATTTGTTAATCCTGGAGCAT
ACCATTTTTGTTTTACACAACTGAGTAAACCTCTCATTTTCTTCACTTTTCATTTTTTTATGCTATCCTTGGGACGCTCTCATTCAGCATTATAGCATTC
ATCTAATTCTTGTCATATGAAAACCATCTCATTATAGTAAATAGTAATTCCTCTCCCCTTGCCTAGCTTTCCGCAATTTATTTGTTAACTCAAAAATCTT
AGAGGCATTTTCTACATCAGAATAAGTCTCTCTAACAACCTCCTTAACATCCCAAGCAAAGGGAACAACCAAATAGGGTTTACTTATGGCAGGTTCCATG
GAGTTAAGTAGCCAAATGATTACCATCGCGTTTTCTGATCTCTAGGGGATCAATTTTGGGTCTCGTAGCTCAGGCATTCTCGTTTCCCCTGCTAGTTAGG
TGATTTAGTTTTCTCAACCATCTATTGTTATAAGGACGGATTTGGCCCCTTTCAAATAATCCTTGTCCTTCTGTTACGAGAGGTAAGTTGAATGGACAAG
GAAAAAATACTCGCTTCCTTCGTTTTTTTCTGC
>LE_HBa0027B05_SP6_137133 (trimmed for quality and cloning vector)
CCACTAGTCTCTGATATTGACTTTCGCGCCTTTTGAGTTTCCTTATTTATTTTCTAACGTAATATTCGGATGAATATGTGTTTCAAATGGACGACAACCT
CTCATCCCTATCTCTTTTAGAAGATCTAGCACATACTTCTTTTGTGACAACATAATAAATTCTTTTGATCTCGCTACTTCCATGCCAAAAAAATAGTTCA
AATGACCCAAATCTTAGATCTCGAATTCTGAGACCAACTATTTTTTGAATCCTTCATTTCTAACAGATCTCTTGTAAGTATGATATCATCGACATACACT
ATTTCGAATAGTTGTCTTCCCCTCAAGAGAATGTCAGATGACATGGTATGATTTGTTAATCCTGGAGCATACCATTTTTGTTTTACACAACTGAGTAAAC
CTCTCATTTTCTTCACTTTTCATTTTTTTATGCTATCCTTGGGACGCTCTCATTCAGCATTATAGCATTCATCTAATTCTTGTCATATGAAAACCATCTC
ATTATAGTAAATAGTAATTCCTCTCCCCTTGCCTAGCTTTCCGCAATTTATTTGTTAACTCAAAAATCTTAGAGGCATTTTCTACATCAGAATAAGTCTC
TCTAACAACCTCCTTAACATCCCAAGCAAAGGGAACAACCAAATAGGGTTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945532
Expected error %
0.3366
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA36616.1| Score 96 E Value 1e-18 Identity 17.70% Align. Length 344bp (52.76%) Frame 2
unnamed protein product [Solanum tuberosum] pir||S25787 hypothetical protein 4 - potato transposon Tst1
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40550.1| Score 72 E Value 9e-13 Identity 51.60% Align. Length 346bp (53.07%) Frame 2
putative receptor kinase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027B05
Clone
Clone name
hba-27b5
LE_HBa0027B05
C11HBa0027B05
P027B05
Clone type
BAC
Contamination
none
Estimated length
150,122
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found