Clone Read LE_HBa0027B05_T7_137134

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027B05_T7_137134
Primer
T7
ID from Seq. Facility
LE_HBa_027_B05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
770 trimmed for vector and quality, 879 raw
Genbank Accession
Sequence
>LE_HBa0027B05_T7_137134 (raw untrimmed)
GCTCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAACTTGATAAAAATGGAAACCTATTTTACCTCTTTCAAACTTACTCAAC
TCAAGAAATACTCAACATTACTCAACTTACGTAATTCAGAAGTACTCAAAGATAAGATACTCAACTCAGTGATTAGATACTCAACTTAAGGATTAGATAC
TCAACTCAATGAAGCACAAATCAACTCACGATACTCAACTTAAGATACTTTAGTGAACTCATTTAAATATAAAGCAGTTTAAAACAAGTGCAATATAAAC
AAGAGTTGTTTAAAAACATGATGTCAACTCATAATGATAATATCATAAAAGACATACCATGTTCCCTCTCAAAGTCTACTTGTGCAATGCATGAATGAAG
TCCAATACCCCCATTCATACTAAGCAGAACCCCTTAAAAAACAATGCAATTACTACTGTGGGAGTTTTTCTAACCAAACACCACCACTATGAGTCTAATT
GGTGATAGAGCATCATCCCCACAATGCCAGAACTGTCCTATACTTTGCAGTATACACAAAACATTACTTATTTGATCCACTATCTTAATTTAAGTAATAA
TCTAAAAAGTATGACCCTTTGATGCCTATGATGACTACTTGGTTTATGGAGAATTGAGTTAATATGAACTCGCATACTCATATATGTGCTCAATACTACT
CCCAAAAAATATACTTAGCTCATATGTTTTTAGAACAATATCTTTCTGTGATTTGAGATAATTATTCAAAACTTAGCTTAAAAGATCTCTTGGAATCAAT
GTTCCTTTTCTGCTCAAAACTCTTTTGGAAATCTCAGTTTCCTCTCATCTTAAAGGGGAAAATATTTACTTTTGGGGAA
>LE_HBa0027B05_T7_137134 (trimmed for quality and cloning vector)
AGCTTGAACTTGATAAAAATGGAAACCTATTTTACCTCTTTCAAACTTACTCAACTCAAGAAATACTCAACATTACTCAACTTACGTAATTCAGAAGTAC
TCAAAGATAAGATACTCAACTCAGTGATTAGATACTCAACTTAAGGATTAGATACTCAACTCAATGAAGCACAAATCAACTCACGATACTCAACTTAAGA
TACTTTAGTGAACTCATTTAAATATAAAGCAGTTTAAAACAAGTGCAATATAAACAAGAGTTGTTTAAAAACATGATGTCAACTCATAATGATAATATCA
TAAAAGACATACCATGTTCCCTCTCAAAGTCTACTTGTGCAATGCATGAATGAAGTCCAATACCCCCATTCATACTAAGCAGAACCCCTTAAAAAACAAT
GCAATTACTACTGTGGGAGTTTTTCTAACCAAACACCACCACTATGAGTCTAATTGGTGATAGAGCATCATCCCCACAATGCCAGAACTGTCCTATACTT
TGCAGTATACACAAAACATTACTTATTTGATCCACTATCTTAATTTAAGTAATAATCTAAAAAGTATGACCCTTTGATGCCTATGATGACTACTTGGTTT
ATGGAGAATTGAGTTAATATGAACTCGCATACTCATATATGTGCTCAATACTACTCCCAAAAAATATACTTAGCTCATATGTTTTTAGAACAATATCTTT
CTGTGATTTGAGATAATTATTCAAAACTTAGCTTAAAAGATCTCTTGGAATCAATGTTCCTTTTCTGCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.933773
Expected error %
0.441
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027B05
Clone
Clone name
hba-27b5
LE_HBa0027B05
C11HBa0027B05
P027B05
Clone type
BAC
Contamination
none
Estimated length
150,122
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found