Clone Read LE_HBa0027E16_T7_137300

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027E16_T7_137300
Primer
T7
ID from Seq. Facility
LE_HBa_027_E16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
731 trimmed for vector and quality, 894 raw
Genbank Accession
Sequence
>LE_HBa0027E16_T7_137300 (raw untrimmed)
CGTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGATATATGTATTGCATGTGACTTATTGCTTTATATTGAGGTAAGTTATT
CATGAGTTGAGCAGAGTCAAGGTAAGTGTTCCTTATTACCTTTATCAATTTTAAGTTATTGTTTAGCATTCCAATTCGCATACTCGTACGTGCAATGTAC
TAATGTAAGTTGGCATGCATCGTCTGATGATGCAGATGCAGGTAACCAGGATCAACATTCAGCATTCAGAGTCTATTGGTGAGCATCCTTGCATCCCGAA
GGACTCTTTTATCATTTGCTTTTCAGTTGTTCGGATGATCGGTCGTCTTGTCCCGACATCCCTCTTTGTTTTAGAGGCTTCGTAGATAGTTAATAGCTCA
TATGTCTTTTATTTATCATTAATATGTTGTTTAAGATTTAAGTTGTCGTTTTGACAAAACTTTTTATCTATTTGAAGTTATGTTAAAGATAATGTGTCAA
GTTAAGTTTTACGTTGTGTAAATAAGTTAGGCCACGGGTTCAGCCGCGGATAGCAATGTCCTTCAAGTTTCAGCCACGTCCAAGATGTAGATTCGGGGAG
TGACAAACTTAATATAAGAGAATAGAGTTTAAAAGTTCTAAGGAGTCTATGAAGTCATGTCTGTAGAGTCCTAGTTATCTGTGTGAAGCGCGCCACATCT
ATAATTTTGAGGCTGCGATATTTAGGAACTATATCACTTCTTTCATATCATTTCATGTGTTAGAATTTAATACGTAAAAAGTTTCCCTCTAAATCTTGCC
TGTGTATATTTTCAGATTAATCTTCCCTCCATGAAAGTGTAGTTCGGGGGTCATCCAGCTTAGAAGGAAGGTCAAAAAACCAAAAATAACCTAA
>LE_HBa0027E16_T7_137300 (trimmed for quality and cloning vector)
AGCTTTAGATATATGTATTGCATGTGACTTATTGCTTTATATTGAGGTAAGTTATTCATGAGTTGAGCAGAGTCAAGGTAAGTGTTCCTTATTACCTTTA
TCAATTTTAAGTTATTGTTTAGCATTCCAATTCGCATACTCGTACGTGCAATGTACTAATGTAAGTTGGCATGCATCGTCTGATGATGCAGATGCAGGTA
ACCAGGATCAACATTCAGCATTCAGAGTCTATTGGTGAGCATCCTTGCATCCCGAAGGACTCTTTTATCATTTGCTTTTCAGTTGTTCGGATGATCGGTC
GTCTTGTCCCGACATCCCTCTTTGTTTTAGAGGCTTCGTAGATAGTTAATAGCTCATATGTCTTTTATTTATCATTAATATGTTGTTTAAGATTTAAGTT
GTCGTTTTGACAAAACTTTTTATCTATTTGAAGTTATGTTAAAGATAATGTGTCAAGTTAAGTTTTACGTTGTGTAAATAAGTTAGGCCACGGGTTCAGC
CGCGGATAGCAATGTCCTTCAAGTTTCAGCCACGTCCAAGATGTAGATTCGGGGAGTGACAAACTTAATATAAGAGAATAGAGTTTAAAAGTTCTAAGGA
GTCTATGAAGTCATGTCTGTAGAGTCCTAGTTATCTGTGTGAAGCGCGCCACATCTATAATTTTGAGGCTGCGATATTTAGGAACTATATCACTTCTTTC
ATATCATTTCATGTGTTAGAATTTAATACGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957093
Expected error %
0.4873
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38768.1| Score 91 E Value 4e-17 Identity 18.80% Align. Length 254bp (34.75%) Frame 1
putative late blight resistance protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38798.1| Score 82 E Value 1e-14 Identity 18.80% Align. Length 254bp (34.75%) Frame 1
hypothetical protein PGEC747E24.8 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027E16
Clone
Clone name
hba-27e16
LE_HBa0027E16
P027E16
Clone type
BAC
Contamination
none
Estimated length
88,424
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found