Clone Read LE_HBa0027G01_SP6_137365

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027G01_SP6_137365
Primer
SP6
ID from Seq. Facility
LE_HBa_027_G01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
680 trimmed for vector and quality, 913 raw
Genbank Accession
Sequence
>LE_HBa0027G01_SP6_137365 (raw untrimmed)
AAGGTTTGGAGGCCCTCAAGATCTTCGAAATTGCTTAACTGTTAACCCCTTGTAACTGTTTCCAGCTAAGAGATAACAATCTTCAAGCTGTTGCTTCACT
GTTTCGACTGTTTCTTCTTTCTTGGTTCTGCTAATGGCTGAACGAATAGTTAGAGTTCTGGGTTTGAGTTTGAGGTGAGAACTGGAATGGGGGATTATGA
AGGGATTGTTGAAGTGGGATTTCACGGAAAATGGGTAAGAGTGAGAGGAAGAGGAAGGTAAGCTGAAGAGAGCAGCCTCCATTGATGATAGCTTGAGAAT
TGGATTGCCTTATCTTTTGTGCTAAGATAGAATTTAGGGGTATTTCATAAACTTTATGTTTTTGAAAATATTTATGTCATACCAAACAAACCATTAAAGA
AGTTAAAAAAGGCAAAATAGGTGTAATATTTACATATATTTTATCGTCTTTAATTTATAAAATTATGTTAGATATATTTTTATTATTATTATTAACAAAA
TTCTTGAGATGATTTGATATGATATATAAAAGATAATAATTTCATAAAATGTAAAATTATTTTATCTTATATTTAAAGATATTAATTATGATTCGATCAG
TTATTTTAAATATATATTATCATTATTTTCAGATGCTTTATTAATTTTTTTTAAAAAAAATAATATAATAATCATATCAATTTTTCTTCTATATTAAAAT
ATTTTATTAATTTTGTTTGAATTTCATAGTAGAGTCGCATTAAGTATAATCAATGCAAATATTTAATGAATTTTTTGGCATTTAGGTGTTATAAAATAGG
GAATTTGTTGATTTTAGTAAAAAAAAATTTTCTGCTTTAGCATTATAAATCCCTCTTGCCTCTTCCATAATCTTTTTACTCATTTTTTATATTTGTGAAA
AATTTTTTCGTAT
>LE_HBa0027G01_SP6_137365 (trimmed for quality and cloning vector)
GAAATTGCTTAACTGTTAACCCCTTGTAACTGTTTCCAGCTAAGAGATAACAATCTTCAAGCTGTTGCTTCACTGTTTCGACTGTTTCTTCTTTCTTGGT
TCTGCTAATGGCTGAACGAATAGTTAGAGTTCTGGGTTTGAGTTTGAGGTGAGAACTGGAATGGGGGATTATGAAGGGATTGTTGAAGTGGGATTTCACG
GAAAATGGGTAAGAGTGAGAGGAAGAGGAAGGTAAGCTGAAGAGAGCAGCCTCCATTGATGATAGCTTGAGAATTGGATTGCCTTATCTTTTGTGCTAAG
ATAGAATTTAGGGGTATTTCATAAACTTTATGTTTTTGAAAATATTTATGTCATACCAAACAAACCATTAAAGAAGTTAAAAAAGGCAAAATAGGTGTAA
TATTTACATATATTTTATCGTCTTTAATTTATAAAATTATGTTAGATATATTTTTATTATTATTATTAACAAAATTCTTGAGATGATTTGATATGATATA
TAAAAGATAATAATTTCATAAAATGTAAAATTATTTTATCTTATATTTAAAGATATTAATTATGATTCGATCAGTTATTTTAAATATATATTATCATTAT
TTTCAGATGCTTTATTAATTTTTTTTAAAAAAAATAATATAATAATCATATCAATTTTTCTTCTATATTAAAATATTTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.903411
Expected error %
0.1642
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g13510.1 Score 65 E Value 3e-11 Identity 23.70% Align. Length 134bp (19.71%) Frame 3
68418.m01560 ribosomal protein L10 family protein ribosomal protein L10- Nicotiana tabacum, EMBL:AB010879
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T01743 Score 91 E Value 3e-17 Identity 20.00% Align. Length 254bp (37.35%) Frame 3
ribosomal protein L10, chloroplast - common tobacco dbj|BAA31511.1| chloroplast ribosomal protein L10 [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027G01
Clone
Clone name
hba-27g1
LE_HBa0027G01
C07HBa0027G01
P027G01
Clone type
BAC
Contamination
none
Estimated length
135,099
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found