Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0027H15_T7_137442

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027H15_T7_137442
Primer
T7
ID from Seq. Facility
LE_HBa_027_H15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
737 trimmed for vector and quality, 915 raw
Genbank Accession
Sequence
>LE_HBa0027H15_T7_137442 (raw untrimmed)
CTCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGATAAAATTGTCAGTACTCATTCAGAACCCTCAAGATACATCTCACAAC
CCAAAGATCCACCACTAAAATTTTCCTTTAAAATAATGCTCAATCACTAAAATTTTCCTTCAAAATAATGCTCAATCTAAGTTCGTGTAGTAATAAACTA
GTTGGTTTCTCAAATGTGAATGCAACACTAAATCTTATTATCTGACCATGTCGTACAACTTGTAACTCCTTTAGTAATTAGTATTCACACTTGACAATCG
ACGTACCTGTTTCCACATAACCCTAGTACTGCCACACCATGAAAGTCCATTAGAAACCTTACTAGAACACATCGTACCTGTCCATAATATCGTACCCAAA
TAGCCCACATATTTCTACCCATTGAATAATTGCAAAACATTATCGAATATGTTATCTCTCTAGACCAAACAATTTGTTTTACTTTTTAGATCAATTCAAT
AACAAAATAACACACTTCCTAACTCTAACCAAGTAAGCATCGATGACTTTCTCGAATATACCCTCACACTATGAAGTCATAGTAGTGTCTTTATTAACCG
ACACTCAACATAAGACTACCACCACATTTTGCGATCGAGAAAATATATCTATTTCTAAGGACATATTTTTTTTTCTTTCTGTTGTTGCTATTTCAACTTC
AAATACTCTAGTAGTACCCATATTTGAAAAAGAGTGAAGAAGTTCAGATACCAATTGGTATCACCTAGATACCCATTGGATTCAAGTAATACCATGAAAG
AAAAAAAAAAAATGACCTTTCCAAAAGTTCTTTAGCTTTTCTAAAAAAAATAAAAGGGCCCCCTTTACAATACCCCAAAAACCTTCTAAATTTTTCCTTG
TGTAGTTGAGAATAA
>LE_HBa0027H15_T7_137442 (trimmed for quality and cloning vector)
AGCTTAAGATAAAATTGTCAGTACTCATTCAGAACCCTCAAGATACATCTCACAACCCAAAGATCCACCACTAAAATTTTCCTTTAAAATAATGCTCAAT
CACTAAAATTTTCCTTCAAAATAATGCTCAATCTAAGTTCGTGTAGTAATAAACTAGTTGGTTTCTCAAATGTGAATGCAACACTAAATCTTATTATCTG
ACCATGTCGTACAACTTGTAACTCCTTTAGTAATTAGTATTCACACTTGACAATCGACGTACCTGTTTCCACATAACCCTAGTACTGCCACACCATGAAA
GTCCATTAGAAACCTTACTAGAACACATCGTACCTGTCCATAATATCGTACCCAAATAGCCCACATATTTCTACCCATTGAATAATTGCAAAACATTATC
GAATATGTTATCTCTCTAGACCAAACAATTTGTTTTACTTTTTAGATCAATTCAATAACAAAATAACACACTTCCTAACTCTAACCAAGTAAGCATCGAT
GACTTTCTCGAATATACCCTCACACTATGAAGTCATAGTAGTGTCTTTATTAACCGACACTCAACATAAGACTACCACCACATTTTGCGATCGAGAAAAT
ATATCTATTTCTAAGGACATATTTTTTTTTCTTTCTGTTGTTGCTATTTCAACTTCAAATACTCTAGTAGTACCCATATTTGAAAAAGAGTGAAGAAGTT
CAGATACCAATTGGTATCACCTAGATACCCATTGGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.939153
Expected error %
0.5458
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027H15
Clone
Clone name
hba-27h15
LE_HBa0027H15
P027H15
Clone type
BAC
Contamination
none
Estimated length
33,499
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found