Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0027N01_T7_137702

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027N01_T7_137702
Primer
T7
ID from Seq. Facility
LE_HBa_027_N01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
742 trimmed for vector and quality, 848 raw
Genbank Accession
Sequence
>LE_HBa0027N01_T7_137702 (raw untrimmed)
TACCTCGATCCCGGGGCTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTTCACGACCATAATCTTCAATATCTTGGACAATGGACACTCTTGCAGC
ATTACCAGTTACCTTGACAGACTCCTCTTGAGTTTGAAAGCTTGGATGAGAACCATCATCCTTCTCACAAGCAGGGTCACGGAAGTCAAGATTGTCTAAC
ATGCTATCATGTGCAAGAGAACTCGTATCACTTTTCTTGTTGCTTGCTTGCAAGTCCTCTTCTTTAACACCCTTTGACATATCTTGGGAAGCAACTGGTA
TGACATAATCTCTGTTGTACCTCTTCGGGGTAAGATTAGTAGACCACTTCATTTCTAACAGATCAGCTGCCATTTCAGCACACTCCAATGAGTCTGTCCT
CATAATACTGGCATCATTTTCTTCCCCAGGAAGCCTGTCTTTTTTCATCGACTTCCTCCCAAAAACCCGGCCTAAAATCCCAGGTCTTTGGGAATTGGCC
CTCACCGAGACATTCTCACCGCTCACATTGATCTGAGTAGTTGAATTAGATTCAGAAGCATCATAGTTGCAACTCTTTGATATTGTTGGCCGCTTACTAC
TGGTTTGCCCGTCAGCATCCTCACCTGAGGATGATGAAGAAGAGAAAGACTCCCCATCTTCTATATCTACATCCTTTATAAAGAAAGCTCGTCCCCTACC
ATCTAAATACATATGAAAACCGGCTTCAACGCCATTGACAGCTATATTAACCACCTTTTCTCTTGCCTTCAAAACTCCCTGAAACTTCCCGAATTGAACC
TACCAAGGGGGATGTTTTCAAACTTCCATTCCCGCCTGCTCCACCACT
>LE_HBa0027N01_T7_137702 (trimmed for quality and cloning vector)
AGCTTTCTTCACGACCATAATCTTCAATATCTTGGACAATGGACACTCTTGCAGCATTACCAGTTACCTTGACAGACTCCTCTTGAGTTTGAAAGCTTGG
ATGAGAACCATCATCCTTCTCACAAGCAGGGTCACGGAAGTCAAGATTGTCTAACATGCTATCATGTGCAAGAGAACTCGTATCACTTTTCTTGTTGCTT
GCTTGCAAGTCCTCTTCTTTAACACCCTTTGACATATCTTGGGAAGCAACTGGTATGACATAATCTCTGTTGTACCTCTTCGGGGTAAGATTAGTAGACC
ACTTCATTTCTAACAGATCAGCTGCCATTTCAGCACACTCCAATGAGTCTGTCCTCATAATACTGGCATCATTTTCTTCCCCAGGAAGCCTGTCTTTTTT
CATCGACTTCCTCCCAAAAACCCGGCCTAAAATCCCAGGTCTTTGGGAATTGGCCCTCACCGAGACATTCTCACCGCTCACATTGATCTGAGTAGTTGAA
TTAGATTCAGAAGCATCATAGTTGCAACTCTTTGATATTGTTGGCCGCTTACTACTGGTTTGCCCGTCAGCATCCTCACCTGAGGATGATGAAGAAGAGA
AAGACTCCCCATCTTCTATATCTACATCCTTTATAAAGAAAGCTCGTCCCCTACCATCTAAATACATATGAAAACCGGCTTCAACGCCATTGACAGCTAT
ATTAACCACCTTTTCTCTTGCCTTCAAAACTCCCTGAAACTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970632
Expected error %
0.22
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42870.1 Score 90 E Value 1e-18 Identity 11.80% Align. Length 569bp (76.68%) Frame 3
68418.m05225 lipin family protein contains Pfam profile: PF04571 lipin, N-terminal conserved region
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB09188.1| Score 90 E Value 7e-17 Identity 11.80% Align. Length 569bp (76.68%) Frame 3
unnamed protein product [Arabidopsis thaliana] ref|NP_199101.1| lipin family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027N01
Clone
Clone name
hba-27n1
LE_HBa0027N01
P027N01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found