Clone Read LE_HBa0027O17_SP6_137781

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027O17_SP6_137781
Primer
SP6
ID from Seq. Facility
LE_HBa_027_O17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
108 trimmed for vector and quality, 904 raw
Sequence
>LE_HBa0027O17_SP6_137781 (raw untrimmed)
TTAAAGGCGGGCGTCGCACAAAATAGAAACCCCAAAATCAAATCATATCACAAATCCATTCAAACTCAAAAAATCCCGACAAGTGGTTTGGCTTGACTTG
ATTTAGTATTGGAAAAATATTCGACTATATTTGGGTTGGTTTNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN
>LE_HBa0027O17_SP6_137781 (trimmed for quality and cloning vector)
AAAATCAAATCATATCACAAATCCATTCAAACTCAAAAAATCCCGACAAGTGGTTTGGCTTGACTTGATTTAGTATTGGAAAAATATTCGACTATATTTG
GGTTGGTT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.903538
Expected error %
0.4827
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027O17
Clone
Clone name
hba-27o17
LE_HBa0027O17
P027O17
Clone type
BAC
Contamination
none
Estimated length
97,474
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found