Clone Read LE_HBa0027O17_T7_137782

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0027O17_T7_137782
Primer
T7
ID from Seq. Facility
LE_HBa_027_O17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
777 trimmed for vector and quality, 866 raw
Genbank Accession
Sequence
>LE_HBa0027O17_T7_137782 (raw untrimmed)
CTCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTACAAAGATCAAAAAATGGCACCATTTATGAGATGAGCACTCGTCTTAAAC
ATTTAGAGCTTGACCTTTCCATGACACTCCGCTCATTGAAATCCAAGAGTGAGGAGTTCAGTTCAAAGGAGGTATTAATCTGTGTCTTCTGTTTTTCTTA
ATAACTGCGGTGTCTGAGCCAACTTGCGCGCACTTCACCTAATTTTACGGGATACATGTTACCTCCCGCCAGCACAGTATCGGGTAACACTGTCCAACAA
GGCTTGGACAGATAGGTAAAAATCTGTATCTTTTATTTCCCCTAGCATCATATATTAATATCTTTCTTATGTAAAATAATGGATTAGTTTAGCTGTGTTT
CCCTGGATGCAATTATTCCACCAAAAGGAATTGTTTCTTTATTTTGTTGAATAGATGTCAACAGGGAAATTCTCGATAATTTCTTTACCATGATTTGTTT
GTGAACATTACATAATTTCTTGTCAAGCTAAACTTTTATATCACATTTCCTATTGCCTTTTAGCACATCAACCTCCCCAAAAGTTCTATTAGGAATTTAA
ATTCAATGCATAAAATTGCTTCTTTCGACTTCACACCCTTTCCCATAGAAAAGCTGAAAATAAAACTGTTAAAGACATTAATGTTAAATAAAGTAAGTAT
CCCCTCAATATGAGGTTCACAATCTCATGGTATCCGAGCCAGAGCAGGTAGTGGTCTTGGATTCAAGTCCTACTCCCTGCCATTAACAAAAAGTATTTCC
AAGTGCTTGACTCGGGAAAATGAATTAGGTCTATGTGTGAAAGGATGTGTTTATTACATAATTAAG
>LE_HBa0027O17_T7_137782 (trimmed for quality and cloning vector)
AGCTTTACAAAGATCAAAAAATGGCACCATTTATGAGATGAGCACTCGTCTTAAACATTTAGAGCTTGACCTTTCCATGACACTCCGCTCATTGAAATCC
AAGAGTGAGGAGTTCAGTTCAAAGGAGGTATTAATCTGTGTCTTCTGTTTTTCTTAATAACTGCGGTGTCTGAGCCAACTTGCGCGCACTTCACCTAATT
TTACGGGATACATGTTACCTCCCGCCAGCACAGTATCGGGTAACACTGTCCAACAAGGCTTGGACAGATAGGTAAAAATCTGTATCTTTTATTTCCCCTA
GCATCATATATTAATATCTTTCTTATGTAAAATAATGGATTAGTTTAGCTGTGTTTCCCTGGATGCAATTATTCCACCAAAAGGAATTGTTTCTTTATTT
TGTTGAATAGATGTCAACAGGGAAATTCTCGATAATTTCTTTACCATGATTTGTTTGTGAACATTACATAATTTCTTGTCAAGCTAAACTTTTATATCAC
ATTTCCTATTGCCTTTTAGCACATCAACCTCCCCAAAAGTTCTATTAGGAATTTAAATTCAATGCATAAAATTGCTTCTTTCGACTTCACACCCTTTCCC
ATAGAAAAGCTGAAAATAAAACTGTTAAAGACATTAATGTTAAATAAAGTAAGTATCCCCTCAATATGAGGTTCACAATCTCATGGTATCCGAGCCAGAG
CAGGTAGTGGTCTTGGATTCAAGTCCTACTCCCTGCCATTAACAAAAAGTATTTCCAAGTGCTTGACTCGGGAAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963715
Expected error %
0.5318
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0027O17
Clone
Clone name
hba-27o17
LE_HBa0027O17
P027O17
Clone type
BAC
Contamination
none
Estimated length
97,474
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found