Clone Read LE_HBa0028C05_T7_137950

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0028C05_T7_137950
Primer
T7
ID from Seq. Facility
LE_HBa_028_C05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
869 trimmed for vector and quality, 1005 raw
Genbank Accession
Sequence
>LE_HBa0028C05_T7_137950 (raw untrimmed)
GGAAAACCGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAATAGTTTTACATAGAAGAGGAGTAGAGGACTATTGAGTATTGACA
CTAGAATTACACGTTTATAATTTGCACCCTTGTTAAGAGTTCTGCTTATACTCCATTCCCTCCCATAGCATCTTCTCTTCTTCTACCACTTCTGCTTCTC
CTTCTTAAGACCAGTAAATTCTTAACAATATACATCTGATTTTCTCTTTTTTTATTATTCAAGTAAGCTAGACAAAGTCAGATCAGTACTTGTAACTTCC
TCTTTGTGATCATCGGTTATCTACTCCAAGTTAATTAATCTCCCAACATGAGATAAGATGGTGAAGCTGCATTAAAGTGGAAGAAGGGCATGTGACAACA
TCAATATAAACTTTGAGCACAAGTCACTTAAACCTCGACCTCAACAACTTAAAATGAAGAGGTAAAGCAAAAACGCAGAAAGGGCCTTCACAGGACAGCC
AAGAAATTGCTAGAAATTTTCTTGATAAAGAAAATTTCTAGAATATTTTAAGCTAAGCAAAGCAAGAAAAACAAGAAAAGATCTCACAAGCACAAAGCAA
GAAAATCAAGGATAAATGATCTTGTTTTCATCCTCGTTATATAACCCGTATACACTAAATAAGATTGATAGTTGCAATAAAGAAACTTAAAATGCATAGA
TAAAATGCACTTAAATCCCTCTCTTTCCGCTTCCTCCAGCTGAATACATTTACCTTTTTTCAGTAACCACTAGTCATCCCAACAAAACACAAATTGGAAT
CCTACCACCTTAATAGTTTGGAAATCCCTCATATCCAACATTATATATCTAAGAATTCAAATATTCCAAGAACTGAATGGGCTACCAATAGTTGTTCTCC
TCAATCTTTCCCTTTGTTGTTGCTTAACGGAATTCAAGGGAATATGTTCTTTTCCCATGAAAGTACTTTGCCTTGTCACCCTCCCAAATCTAAATTTGGG
AAACT
>LE_HBa0028C05_T7_137950 (trimmed for quality and cloning vector)
AGCTTGAATAGTTTTACATAGAAGAGGAGTAGAGGACTATTGAGTATTGACACTAGAATTACACGTTTATAATTTGCACCCTTGTTAAGAGTTCTGCTTA
TACTCCATTCCCTCCCATAGCATCTTCTCTTCTTCTACCACTTCTGCTTCTCCTTCTTAAGACCAGTAAATTCTTAACAATATACATCTGATTTTCTCTT
TTTTTATTATTCAAGTAAGCTAGACAAAGTCAGATCAGTACTTGTAACTTCCTCTTTGTGATCATCGGTTATCTACTCCAAGTTAATTAATCTCCCAACA
TGAGATAAGATGGTGAAGCTGCATTAAAGTGGAAGAAGGGCATGTGACAACATCAATATAAACTTTGAGCACAAGTCACTTAAACCTCGACCTCAACAAC
TTAAAATGAAGAGGTAAAGCAAAAACGCAGAAAGGGCCTTCACAGGACAGCCAAGAAATTGCTAGAAATTTTCTTGATAAAGAAAATTTCTAGAATATTT
TAAGCTAAGCAAAGCAAGAAAAACAAGAAAAGATCTCACAAGCACAAAGCAAGAAAATCAAGGATAAATGATCTTGTTTTCATCCTCGTTATATAACCCG
TATACACTAAATAAGATTGATAGTTGCAATAAAGAAACTTAAAATGCATAGATAAAATGCACTTAAATCCCTCTCTTTCCGCTTCCTCCAGCTGAATACA
TTTACCTTTTTTCAGTAACCACTAGTCATCCCAACAAAACACAAATTGGAATCCTACCACCTTAATAGTTTGGAAATCCCTCATATCCAACATTATATAT
CTAAGAATTCAAATATTCCAAGAACTGAATGGGCTACCAATAGTTGTTCTCCTCAATCTTTCCCTTTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.941325
Expected error %
1.7365
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0028C05
Clone
Clone name
hba-28c5
LE_HBa0028C05
C07HBa0028C05
P028C05
Clone type
BAC
Contamination
none
Estimated length
153,662
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found