Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0028M10_SP6_138439

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0028M10_SP6_138439
Primer
SP6
ID from Seq. Facility
LE_HBa_028_M10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
136 trimmed for vector and quality, 894 raw
Sequence
>LE_HBa0028M10_SP6_138439 (raw untrimmed)
AACGGAAGTGTGCGCGCGAGCTGGTAATGCCTGTGTTACTTTTTACACGGCTTNGGACATATATATCGCTAGATATAATAAAAATCTTGTTTTGGGGGAG
ACTCGCAAAATTTTACCAACTGATGACAGTGTCTCAGTAGTGATTGGAACTAGTACGAGAGGCACCGTTGATTCACATAAATTGGTCATCACGATTGGTT
GAAGAGGCGATGCTGTAAAGCTGCT
GCGTATTGCGGTTAGATTGTAGCTGAACTTCTCTAAGTCAAGAGTCCAGATGAGATGTGATGTATGCACTTCAAC
ACTTGTCGTCTCGGACCATAGCAGGTACCTCCAGCCCAGAGGTACATGTCTTTGTCCAAGTCATGTGAATGGAAGTGTCGTGTTGCTCGCCTTGAAGTAC
AATTTCGGGTCGAGTTGCAGGTATGTATTTGCATACAACAAGGTATTTGTAAGTGGTTAGAGTGGTGTGTCGGCCTTGATCCACTGAGATCAAGTTGTGC
TGAAGATTCAGGGCGTGTTCGCTTCGATGCATAAGATGTATATGATCATATGTTGCTACAAGACATAGTCACTCTGTGAATTCATGCAGAGCTTACAACA
TATTTAGATCAAGAGATCGTATGAGCGATTCTAACTATGTGGATTCACGATCCCCAGCCTGGATTCTTTATCTACGTCGATCCGCTCTGGAGTTATTGGC
TATTGGGCACGACTCCCTCTCAATACACTACCACTGGGCGGTCGTGCGACACCGACCTTCGATTGCAAGACATCCTCAGTGCTCTCCTTGTCTTAGTGTC
TGACCTATGCTCTTTTGAGCACTTCAAGTCGGGGAGGGTCTTGCGTAGGTTCTTTCTATTGCATCGGACTCTATCATGATAATAGTGTAGCAGA
>LE_HBa0028M10_SP6_138439 (trimmed for quality and cloning vector)
GCGTATTGCGGTTAGATTGTAGCTGAACTTCTCTAAGTCAAGAGTCCAGATGAGATGTGATGTATGCACTTCAACACTTGTCGTCTCGGACCATAGCAGG
TACCTCCAGCCCAGAGGTACATGTCTTTGTCCAAGT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950116
Expected error %
2.1739
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0028M10
Clone
Clone name
hba-28m10
LE_HBa0028M10
P028M10
Clone type
BAC
Contamination
none
Estimated length
124,710
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found