Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0030J22_SP6_139087

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0030J22_SP6_139087
Primer
SP6
ID from Seq. Facility
LE_HBa_030_J22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
626 trimmed for vector and quality, 806 raw
Genbank Accession
Sequence
>LE_HBa0030J22_SP6_139087 (raw untrimmed)
CGGAAATGTTTGGGCAAAATGGTCGATAACAAAGTACCTTTTTAGAACGGCACTGGCTATCCTTGAATGAAGAAACTGGCCGTTATGAATGATGTTCTTT
ATAAGTTATACAGTGTAACGGTACGTATATTATGTCAAATGAACTTCCTTACAATTTTTTCATCTTTCTAGTTTCTGTTGTATAATTTTTGTTCCAGTTG
ATGTCGATGTCACAAATGAGCACACTTGAACTGATTTCTTTTTTGGAATTCTCAATTGGACTTGAATTTGATACAATTGTATATTTGTTCTTCTTTACAT
TTGCATTTTTTTGTATTCTGCGCCTTGTGTCCCGTTACTTCTTTTTCCAAACTGCTTTGGACTGTTTTTCCTTGATCTGGTAGTCTATCGGAAACAGTCT
CTCTACCTCTGCGATAGGGGTTAAGGTCTGCGTACATCTACCCTCCCCAAATCCCATTTTGTGGGATACACTGGATACGTTGTTGTTGTTGGATTCTGCA
CTTGTGTGTCAAATGTAATGCCTATCGGACCAATGATAAAGACTACATATTTCCGTCTATGTCTGATTCTCTTTGATACAGAGAATCTTACAAAGCGAAT
ATAGATATACAACACAATTATCCTGACTAAACACTTCCTTTTATTGGTTTTGCAGGGAAATTCAAAGCATTTACTGCTGGCTCATCTTTTTGACAAACCA
TGCTTTCTAGGACTCTTAACTTTAAAGGTGTAAATCACACTTCTCCCCGAATCCCTATTTTACTGGCTCCAATAAAAAAGGGTGTTTTAAGTGGTTATCC
AAATTA
>LE_HBa0030J22_SP6_139087 (trimmed for quality and cloning vector)
ACGGCACTGGCTATCCTTGAATGAAGAAACTGGCCGTTATGAATGATGTTCTTTATAAGTTATACAGTGTAACGGTACGTATATTATGTCAAATGAACTT
CCTTACAATTTTTTCATCTTTCTAGTTTCTGTTGTATAATTTTTGTTCCAGTTGATGTCGATGTCACAAATGAGCACACTTGAACTGATTTCTTTTTTGG
AATTCTCAATTGGACTTGAATTTGATACAATTGTATATTTGTTCTTCTTTACATTTGCATTTTTTTGTATTCTGCGCCTTGTGTCCCGTTACTTCTTTTT
CCAAACTGCTTTGGACTGTTTTTCCTTGATCTGGTAGTCTATCGGAAACAGTCTCTCTACCTCTGCGATAGGGGTTAAGGTCTGCGTACATCTACCCTCC
CCAAATCCCATTTTGTGGGATACACTGGATACGTTGTTGTTGTTGGATTCTGCACTTGTGTGTCAAATGTAATGCCTATCGGACCAATGATAAAGACTAC
ATATTTCCGTCTATGTCTGATTCTCTTTGATACAGAGAATCTTACAAAGCGAATATAGATATACAACACAATTATCCTGACTAAACACTTCCTTTTATTG
GTTTTGCAGGGAAATTCAAAGCATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.938664
Expected error %
0.313
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0030J22
Clone
Clone name
hba-30j22
LE_HBa0030J22
P030J22
Clone type
BAC
Contamination
none
Estimated length
80,023
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found