Clone Read LE_HBa0030M13_SP6_139213

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0030M13_SP6_139213
Primer
SP6
ID from Seq. Facility
LE_HBa_030_M13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
618 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0030M13_SP6_139213 (raw untrimmed)
AAAATTTTTTGCCCTTTCGGGGGCGAGAACCCTTTATTTCCTATTGAAGTTGATAGAGCTTCGCACCGTTTTTCTGATCATACCTATCTTACAGTTCCTC
CCACAATTCTTTTGCATTATTAACATACTACAGGCTATCAACTAAATCCTTTGATAGAGAATTGAGGATCCATGATGTGACCATATCATCACAACGTTCC
CACTAAGCAAATGTGGGTGAAGTTGCATTTGGTTTCTGCAATTTGCCATTAATAAAACCTACTTTGTTTTTCACAGATAATGCACGAAGAACTCCACGTC
GCCATTATCTATAACCAGTCCCGTAAAAAATCACCGTAATTATAGCAGACCCAGCACTTTCTAATGAATGCATGTACAATGGCTGACTAGCATCGATGAC
TTGGCGATTTGGGATTTGAGGAACATCTGCATTTTGATCCATGAAATTGAAGGATGTTGATGGAAAAATTGAGCTAAAACTTTGAAATCTAAGTACAGAA
ATTGAAAAGAAAAAATTCGAGAAGATGAAGAACGGTTATTCGTGAAAGAGATGAAGAATGAATGAGTGCTGCAGAAGATGAAGAAGAGATCAGTGTCTGT
GCTCTGATACCATGTTAGAATTGTATACAAATAATTGCAGAACCTCCATTAATGGAGTAGAGCAAACTTGAAGAGATGAACAGATTGTGTATTTTGGAAA
AAATGAAAAGGTATGATCTATATTCACATGCCTGGTATATTTATACATGTATATACAATGAAAGAAAAAATATCTTCTTTACCTAACCTTCAACTAACTA
ACTAAATAACAAAATTCACCTAAATTAAATTCCTTTTCAATAATTAA
>LE_HBa0030M13_SP6_139213 (trimmed for quality and cloning vector)
TATTGAAGTTGATAGAGCTTCGCACCGTTTTTCTGATCATACCTATCTTACAGTTCCTCCCACAATTCTTTTGCATTATTAACATACTACAGGCTATCAA
CTAAATCCTTTGATAGAGAATTGAGGATCCATGATGTGACCATATCATCACAACGTTCCCACTAAGCAAATGTGGGTGAAGTTGCATTTGGTTTCTGCAA
TTTGCCATTAATAAAACCTACTTTGTTTTTCACAGATAATGCACGAAGAACTCCACGTCGCCATTATCTATAACCAGTCCCGTAAAAAATCACCGTAATT
ATAGCAGACCCAGCACTTTCTAATGAATGCATGTACAATGGCTGACTAGCATCGATGACTTGGCGATTTGGGATTTGAGGAACATCTGCATTTTGATCCA
TGAAATTGAAGGATGTTGATGGAAAAATTGAGCTAAAACTTTGAAATCTAAGTACAGAAATTGAAAAGAAAAAATTCGAGAAGATGAAGAACGGTTATTC
GTGAAAGAGATGAAGAATGAATGAGTGCTGCAGAAGATGAAGAAGAGATCAGTGTCTGTGCTCTGATACCATGTTAGAATTGTATACAAATAATTGCAGA
ACCTCCATTAATGGAGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960261
Expected error %
0.256
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g21280.1 Score 67 E Value 1e-11 Identity 12.30% Align. Length 260bp (42.07%) Frame 1
68414.m02659 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89730.1| Score 115 E Value 8e-25 Identity 14.80% Align. Length 383bp (61.97%) Frame 1
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40537.1| Score 99 E Value 8e-20 Identity 25.60% Align. Length 194bp (31.39%) Frame 1
hypothetical protein PGEC407.3 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0030M13
Clone
Clone name
hba-30m13
LE_HBa0030M13
P030M13
Clone type
BAC
Contamination
none
Estimated length
98,179
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found