Clone Read LE_HBa0030M13_T7_139214

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0030M13_T7_139214
Primer
T7
ID from Seq. Facility
LE_HBa_030_M13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
775 trimmed for vector and quality, 864 raw
Genbank Accession
Sequence
>LE_HBa0030M13_T7_139214 (raw untrimmed)
GCTGGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTTCCCATCTGTATATTTCTTATTGAACTCATTGTACTTTTGTTTCTGCA
CCAATCTTATTCCACCTTATGGTTTGAGTAAGGAACCTAAATAGTTTTGATAGATCATTTAGGAAAGATGTTCACTTTATTAGTTCATATTGGTTTTACT
GAATTAAACATTAAGTTTTGTTTACTTATTTATTTATGGAGTAAACCAAGATTCTTCTTTCTGTAGTAATCTGTGAACATGTGTATCTTATCTAGTTCGG
AGAATGATTCTTGCTCAAATTTTGTTAGCAGATTCTGTGAATGCTAATTGTGCATCCTCCACTTTCTCAGAATCCTTCAAGTATTCCTACCCAACAAATA
TTTGAAACTTTTCAATTTCAATAACTTCTTGATCGCGTGTTGGAGCAATAAATGACGAACATGCAAGAGAATATGCAAATGGATATTCAGGAAATATGGA
AGCTCAGGTAAATAATGTGGTTCCTTTTGCTGTGGCTCAGATGCTTGGTTTCACTCTCAACCACCAACAAATGGATCTGGTTCTTCCCTAAATGCACCTT
AGATAATTTTTGTTGCTTACTTGTGTTTTAAGATATGTTTTTGCTAGTACACATGTACTTTGCTATTCTAGAAATGACAATATTATGATTATGCTTATTT
CGAGAATTCGATTAGATATAACTTTTGTTTTCATCTTGGTCTCAAATATTAGAAAATTACATTTGTTATTTTTTCATTCAATTTCTGGCATGGATTTAAC
TAAAAAAAGAAAAATATCCCCTACCTATTTTTTAGGCTTGGTCTTTCAGGGAAAAAATATTTTC
>LE_HBa0030M13_T7_139214 (trimmed for quality and cloning vector)
AGCTTTCTTCCCATCTGTATATTTCTTATTGAACTCATTGTACTTTTGTTTCTGCACCAATCTTATTCCACCTTATGGTTTGAGTAAGGAACCTAAATAG
TTTTGATAGATCATTTAGGAAAGATGTTCACTTTATTAGTTCATATTGGTTTTACTGAATTAAACATTAAGTTTTGTTTACTTATTTATTTATGGAGTAA
ACCAAGATTCTTCTTTCTGTAGTAATCTGTGAACATGTGTATCTTATCTAGTTCGGAGAATGATTCTTGCTCAAATTTTGTTAGCAGATTCTGTGAATGC
TAATTGTGCATCCTCCACTTTCTCAGAATCCTTCAAGTATTCCTACCCAACAAATATTTGAAACTTTTCAATTTCAATAACTTCTTGATCGCGTGTTGGA
GCAATAAATGACGAACATGCAAGAGAATATGCAAATGGATATTCAGGAAATATGGAAGCTCAGGTAAATAATGTGGTTCCTTTTGCTGTGGCTCAGATGC
TTGGTTTCACTCTCAACCACCAACAAATGGATCTGGTTCTTCCCTAAATGCACCTTAGATAATTTTTGTTGCTTACTTGTGTTTTAAGATATGTTTTTGC
TAGTACACATGTACTTTGCTATTCTAGAAATGACAATATTATGATTATGCTTATTTCGAGAATTCGATTAGATATAACTTTTGTTTTCATCTTGGTCTCA
AATATTAGAAAATTACATTTGTTATTTTTTCATTCAATTTCTGGCATGGATTTAACTAAAAAAAGAAAAATATCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.934762
Expected error %
1.2108
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0030M13
Clone
Clone name
hba-30m13
LE_HBa0030M13
P030M13
Clone type
BAC
Contamination
none
Estimated length
98,179
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found