Clone Read LE_HBa0031D22_SP6_139567

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031D22_SP6_139567
Primer
SP6
ID from Seq. Facility
LE_HBa_031_D22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
774 trimmed for vector and quality, 900 raw
Genbank Accession
Sequence
>LE_HBa0031D22_SP6_139567 (raw untrimmed)
TTTGGTTAAAACGATGCGTTTCGAATTTCTACATACGGATTCCTCGGCACCAGTAGGCAACGTTTTTTCCCAACCCGAACTAGTCTACAATATCCTCTAC
GGCAGGCTTATTAGGGATGAAGATGTCTTCTTGTTTTCTCGCTCTCCTTTCTATCCCAGTTTCTACCGTGTCTATACAATCTCTGATATCCTCCAAAGTT
GGGTTAATTTCTGCGGTTCTGAATCGAAACACTATCTTTTGGCTATCCAAATATCCCGTAAGGACCTCAACCAATTATGGCCAACCGTTCATGTTAATCA
ATTTATGTTAATGCACCCACATATTTGTTGACGGTTCTTCTATGATCTCCGTCGATAACACATTGTGAGTTGAGGTGGTGTTGCTATGACCATATCTACA
AAATAGAAGCTAGTTAGGTTTTCCCCAACACAAATTGATTTTCACACATACATCATTCAAATGTCACATAAAATTATACGTCGTGAGGTCGAAGACCTTA
GACACGGTTTTGGTGCTTTTTCTACTAAATGGACTTAATACACCTTGGGTATTAATCCGTCTTATGCTAATGCTTAATATTTGGTTTTGGTTTCGCTCTA
TCTTAGGTTTACTAGAATAGTTTTCAAGATGAAGGTTACCCGAGTCGGACAAACATCGGGGTGAAGCTACCAAACAACGTCGGATGACCACATTCCAACT
ATTTGTTTGATACTCCCAAATGAATTCTTGTGTATTTCTAAAGAAAGTCGTGGAAAGCCACGTAATTTTTGTTTTCCTAATGCATACTATTTGTCGTTTG
GCGGAAGAATGCAATGGAAATGCAACAAATTTAATACTAAGGCTAGTTTTAATTTAGAATCCTCTGTTTCCCCACAATTCGCAATTCTGTTTATCGAAAG
>LE_HBa0031D22_SP6_139567 (trimmed for quality and cloning vector)
TTTTCCCAACCCGAACTAGTCTACAATATCCTCTACGGCAGGCTTATTAGGGATGAAGATGTCTTCTTGTTTTCTCGCTCTCCTTTCTATCCCAGTTTCT
ACCGTGTCTATACAATCTCTGATATCCTCCAAAGTTGGGTTAATTTCTGCGGTTCTGAATCGAAACACTATCTTTTGGCTATCCAAATATCCCGTAAGGA
CCTCAACCAATTATGGCCAACCGTTCATGTTAATCAATTTATGTTAATGCACCCACATATTTGTTGACGGTTCTTCTATGATCTCCGTCGATAACACATT
GTGAGTTGAGGTGGTGTTGCTATGACCATATCTACAAAATAGAAGCTAGTTAGGTTTTCCCCAACACAAATTGATTTTCACACATACATCATTCAAATGT
CACATAAAATTATACGTCGTGAGGTCGAAGACCTTAGACACGGTTTTGGTGCTTTTTCTACTAAATGGACTTAATACACCTTGGGTATTAATCCGTCTTA
TGCTAATGCTTAATATTTGGTTTTGGTTTCGCTCTATCTTAGGTTTACTAGAATAGTTTTCAAGATGAAGGTTACCCGAGTCGGACAAACATCGGGGTGA
AGCTACCAAACAACGTCGGATGACCACATTCCAACTATTTGTTTGATACTCCCAAATGAATTCTTGTGTATTTCTAAAGAAAGTCGTGGAAAGCCACGTA
ATTTTTGTTTTCCTAATGCATACTATTTGTCGTTTGGCGGAAGAATGCAATGGAAATGCAACAAATTTAATACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971361
Expected error %
0.3022
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89785.1| Score 114 E Value 6e-29 Identity 36.20% Align. Length 480bp (62.02%) Frame 2
late blight resistance protein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89786.1| Score 108 E Value 2e-22 Identity 21.90% Align. Length 227bp (29.33%) Frame 2
hypothetical protein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031D22
Clone
Clone name
hba-31d22
LE_HBa0031D22
P031D22
Clone type
BAC
Contamination
none
Estimated length
95,428
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found