Clone Read LE_HBa0031F16_SP6_139651

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031F16_SP6_139651
Primer
SP6
ID from Seq. Facility
LE_HBa_031_F16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
575 trimmed for vector and quality, 921 raw
Genbank Accession
Sequence
>LE_HBa0031F16_SP6_139651 (raw untrimmed)
GGAATTTACCGAAAAAGAGGAAAGGGACCATCCGGTAGCTCCATAGACGACCATTGTTAAGGAAACATCGATTGCCTCTGACAAGCCCTTAGTCGTTTTT
GTTTCTTTGGTCGTCGTTTCAGCTTGTTGCTGATGATTTTTGTTTTGGGCTTGGGTCACTTCTGGACCCAACCTATTTGTGTTAGTTTGGACTCTCTTTT
TACTCAATAAATGGGCCTTCCCCATATTTAAACAAAAAAAAAAAAAAGTATAAATTTAAGGAATCACATAGTGTAATACAATAATTACATTCTATCCTGA
CAAATTTAATATTTACTAAAAATTTCTTAAAATTGTTGTGGCGTGATACATTAGTATGTTGTGATACATGGTAAGTGATACACAGTAACTTAAAACTGTT
AATATTAAAAGGGGGTCATTTAAATTTGTTATCTAAATCAACTTAAATTACGGTAACAGCTCATTAATAAGCATTAATTCAGCACGTAATTGGATAACAA
TTTCAAATTTTGGAAATTCAAGATTATATTATCTAGTTTGAAGACATTTTTATGAACATGCAGTTATTAAACTTATTGACTGATACGTGATAACAATTTT
CAAAAACTCGTGGGTAAATAAAAAAAAAATGATACACATCAAATTCATGTATAAATGCATCGTCTAAACACTATAACACACTGAGTCGATATGTATCAGC
AAACACACTTGATGGGGCAGTTATTAAACTTTATTGACTGATACATGATAACAATTTTCAAAAACTCTTGATACATAGGAAATCATATATACACATTCTA
ATTNTCTTCCGTGCAGATTGTTTATTGTGNTTAACACAAGAAATACTTAGATTAAACTTATGTCTGAACATGAAAAAATTTTAAAAATTCAAGATCGAAT
GGGGTTCCTTACAAAATTTTT
>LE_HBa0031F16_SP6_139651 (trimmed for quality and cloning vector)
CGGTAGCTCCATAGACGACCATTGTTAAGGAAACATCGATTGCCTCTGACAAGCCCTTAGTCGTTTTTGTTTCTTTGGTCGTCGTTTCAGCTTGTTGCTG
ATGATTTTTGTTTTGGGCTTGGGTCACTTCTGGACCCAACCTATTTGTGTTAGTTTGGACTCTCTTTTTACTCAATAAATGGGCCTTCCCCATATTTAAA
CAAAAAAAAAAAAAAGTATAAATTTAAGGAATCACATAGTGTAATACAATAATTACATTCTATCCTGACAAATTTAATATTTACTAAAAATTTCTTAAAA
TTGTTGTGGCGTGATACATTAGTATGTTGTGATACATGGTAAGTGATACACAGTAACTTAAAACTGTTAATATTAAAAGGGGGTCATTTAAATTTGTTAT
CTAAATCAACTTAAATTACGGTAACAGCTCATTAATAAGCATTAATTCAGCACGTAATTGGATAACAATTTCAAATTTTGGAAATTCAAGATTATATTAT
CTAGTTTGAAGACATTTTTATGAACATGCAGTTATTAAACTTATTGACTGATACGTGATAACAATTTTCAAAAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.933132
Expected error %
0.2126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031F16
Clone
Clone name
hba-31f16
LE_HBa0031F16
P031F16
Clone type
BAC
Contamination
none
Estimated length
102,369
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found