Clone Read LE_HBa0031F16_T7_139652

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031F16_T7_139652
Primer
T7
ID from Seq. Facility
LE_HBa_031_F16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
810 trimmed for vector and quality, 939 raw
Genbank Accession
Sequence
>LE_HBa0031F16_T7_139652 (raw untrimmed)
CTACCCCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCACATGATTCCTGGGATCTCTCCTTTAATCCTTGAGTCTACCCACTC
ACTTGCTATTAACGCGGCATCCATAATTTGTCTTCCTTGAATAACGGCCATTTGGTGATTGTTCTCTAATTTGCTTATCACTTTCTTTAATCTCTCCGCC
AACAGCTTACCATAGACCTTGTACACACCACTAATGAGACTGATGGGTCTGAAATCCCTAAGTTCCATAGCTCCTGTCTTCTTTGGGATTAGAGCCACAT
AGGTGGCGTTGAGACTCTTCCCTATTTTCATGGAATTGTCTCACTGCATTCATGAAGTCTGTCTTCAGTATCTCCCAAAAGTTTTGGAAAAAACTCATCG
GAGAGCCATCTGGTCTGGGGGCCTTATCACTAGAACATGATTTTATGCGATTGAAAACTTCATCTTCCTCAAATTGCCTCTGCAGCCATACATTTTCCTC
TTGTGTAATGTTTTCCGCTCCCTGTACATTAAATTCTGGCCTCCATTGTTCCGTTTTTATGTAAAGATTTTGATAGTAATTGATTATGGTTCCTTTAATT
TCTTCTGAATCTGTTAATGTAACCCCTTCACCATCAGCTTGTCAATGGTGTTGAATCTTTTGTGTGCTGTAGCATCCAGTGAAAATACTTGGTATTTTTG
TCTATGCAATTTAGGAAGATCTGGATAACAGGTCCCTGGTGTATTACCTGGACTGTTTGTAAGAAGAAATTGGATTGTTCAAATGACGAACATAGCCATA
CTACATAGTATAAACTGTACATGTTTGTGAAATAGCTTTTTACCTAGAATGCAATGCCGATATGTAAAATCCATTGAGGAACCCATCCCCCCTTGATTGG
AAAATAATTACGTCGGGCTTGTTTTGTTTGGGAAAAATC
>LE_HBa0031F16_T7_139652 (trimmed for quality and cloning vector)
AGCTTGCACATGATTCCTGGGATCTCTCCTTTAATCCTTGAGTCTACCCACTCACTTGCTATTAACGCGGCATCCATAATTTGTCTTCCTTGAATAACGG
CCATTTGGTGATTGTTCTCTAATTTGCTTATCACTTTCTTTAATCTCTCCGCCAACAGCTTACCATAGACCTTGTACACACCACTAATGAGACTGATGGG
TCTGAAATCCCTAAGTTCCATAGCTCCTGTCTTCTTTGGGATTAGAGCCACATAGGTGGCGTTGAGACTCTTCCCTATTTTCATGGAATTGTCTCACTGC
ATTCATGAAGTCTGTCTTCAGTATCTCCCAAAAGTTTTGGAAAAAACTCATCGGAGAGCCATCTGGTCTGGGGGCCTTATCACTAGAACATGATTTTATG
CGATTGAAAACTTCATCTTCCTCAAATTGCCTCTGCAGCCATACATTTTCCTCTTGTGTAATGTTTTCCGCTCCCTGTACATTAAATTCTGGCCTCCATT
GTTCCGTTTTTATGTAAAGATTTTGATAGTAATTGATTATGGTTCCTTTAATTTCTTCTGAATCTGTTAATGTAACCCCTTCACCATCAGCTTGTCAATG
GTGTTGAATCTTTTGTGTGCTGTAGCATCCAGTGAAAATACTTGGTATTTTTGTCTATGCAATTTAGGAAGATCTGGATAACAGGTCCCTGGTGTATTAC
CTGGACTGTTTGTAAGAAGAAATTGGATTGTTCAAATGACGAACATAGCCATACTACATAGTATAAACTGTACATGTTTGTGAAATAGCTTTTTACCTAG
AATGCAATGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955923
Expected error %
0.8957
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40556.1| Score 110 E Value 2e-31 Identity 71.40% Align. Length 474bp (58.52%) Frame 1
hypothetical protein PGEC542.21 [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA73798.1| Score 73 E Value 2e-24 Identity 30.30% Align. Length 558bp (68.89%) Frame 1
reverse transcriptase [Beta vulgaris subsp. vulgaris] pir||T14619 reverse transcriptase - beet retrotransposon (fragment)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031F16
Clone
Clone name
hba-31f16
LE_HBa0031F16
P031F16
Clone type
BAC
Contamination
none
Estimated length
102,369
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found