Clone Read LE_HBa0031F23_SP6_139665

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031F23_SP6_139665
Primer
SP6
ID from Seq. Facility
LE_HBa_031_F23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
618 trimmed for vector and quality, 874 raw
Genbank Accession
Sequence
>LE_HBa0031F23_SP6_139665 (raw untrimmed)
GGTTTATTATTGTCGTCAGCTATATTTAGTAAGGTCTAACCATAATCGGGATCTTTTGTTACCTAGTAGAATGTCCACAAATGTGCATATATGTGAATGT
TGTGGGCTTAAAGTAGGTTGTTTTTGTATAACAAATACATGATTATGTTCAATATTAGTGCTTTTGTAAGTAGCCAACTAAAATGATCTTCAGATTGCTC
AAGCAGTTGATCCAAACGGTAAGTTCATCATCTTCTACAAGATGTTTTTATTTTCTTCTTATCTGAGACTATATTGAACTTTTCTTTTCTCGCAGACTAT
TCAACAGTTGGGGTAATCACAAAGATCCAGTCAGAAGTACAAAGTACTCAGATGCTATTTTGTCAAGTGTTGTTGAGGATGTTGTTTATGTGTTTGTCAT
TGAAGGATAATGTTACAAAAATAGGGGACTTCTTTTGGGGGAAAATGTAATTGTACGTCTTTGTTGTATGGGTTAACTTTTGTAATTAAACAATGAATTA
TGCTAAGTTTCATTCACTTTAAATGAAGGTGTATATTTTAACTGTGAATTATGTGTGAGTGAATTCTTTCCTGATGAATGTTGTCTCCTTTGGCTTAATT
TGTATAGTCACGTAGTTGAGGTGCTCTAAAATAAAGAATATCACATTATTAAAAAAGCACTACCAGGTTGAAAGTAACAGACACCATATAGTAATTGTGG
CAAAGACAAAGATTTAAATCCTTTGGATTGACATTTTGTGAAAGTTACCAATTAACATTCAAAGAGAAACTAATTGAATTGTAATCCTGTATGGAAATTG
GAATTGGACTTTGAGCAACTGATGAAATAATATACAAATAAGCCAAGGAAGATCAGAAAGGTTATTGCCAAAGA
>LE_HBa0031F23_SP6_139665 (trimmed for quality and cloning vector)
AGTAGAATGTCCACAAATGTGCATATATGTGAATGTTGTGGGCTTAAAGTAGGTTGTTTTTGTATAACAAATACATGATTATGTTCAATATTAGTGCTTT
TGTAAGTAGCCAACTAAAATGATCTTCAGATTGCTCAAGCAGTTGATCCAAACGGTAAGTTCATCATCTTCTACAAGATGTTTTTATTTTCTTCTTATCT
GAGACTATATTGAACTTTTCTTTTCTCGCAGACTATTCAACAGTTGGGGTAATCACAAAGATCCAGTCAGAAGTACAAAGTACTCAGATGCTATTTTGTC
AAGTGTTGTTGAGGATGTTGTTTATGTGTTTGTCATTGAAGGATAATGTTACAAAAATAGGGGACTTCTTTTGGGGGAAAATGTAATTGTACGTCTTTGT
TGTATGGGTTAACTTTTGTAATTAAACAATGAATTATGCTAAGTTTCATTCACTTTAAATGAAGGTGTATATTTTAACTGTGAATTATGTGTGAGTGAAT
TCTTTCCTGATGAATGTTGTCTCCTTTGGCTTAATTTGTATAGTCACGTAGTTGAGGTGCTCTAAAATAAAGAATATCACATTATTAAAAAAGCACTACC
AGGTTGAAAGTAACAGAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.935753
Expected error %
0.2172
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031F23
Clone
Clone name
hba-31f23
LE_HBa0031F23
C02HBa0031F23
P031F23
Clone type
BAC
Contamination
none
Estimated length
112,628
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found