Clone Read LE_HBa0031F23_T7_139666

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031F23_T7_139666
Primer
T7
ID from Seq. Facility
LE_HBa_031_F23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
1 trimmed for vector and quality, 1086 raw
Sequence
>LE_HBa0031F23_T7_139666 (raw untrimmed)
AGTGATAATGATGCTAATCCTTCTACTTTATTTATATAACGAGAAGGCCCTCTCTATAATAAAGAGTTCACNTCANANACTCTAACNCANACATCTCTAA
TTNTATACCATTCTAACCTCAATACATACTNCATAACAAAGAGGGTCACATAACGCTCATACTACATCCTCATNAAGCACTTCATATTTTNCTACCATTN
AAAAAGTACTAAATTNATCATTGTGGAGGAAGAGAGGCAGAGAAAGCAGCTACCTAGCTNCATCACAACTATCATGCGTGTGCTAGACTGACACATCTCT
GACATTATTGATGATCTTGAGATTCTGTTGCTTGTATGTTGTACTCTAAGTTCTTATGACTTGACTCCGCTTNGATGAGCGGCCCACTCACTCTTTCTCG
CCACTAGGGAGTTGGTNCACTAATCATATACATTTAACNCCTCCCCTCTAGATNATCTACGAACACCTATATTCCTTTAACATACTTCGTTTGCGATACA
CTTATTAATGCAATCTACTATCTATATACACCATACCATATATCATGATGGGTGGTGGGCGGGCGCAGCTTACAATCTTCTATTTTTTTTCGTACGCTCC
TCGCCCGCCCATCTGTGACATATCATTTTCTCTTATATANATAATGCTGTACTTATTTATCCTTAATAACTTACCTACTTCTATCTTCTATTNACTTGTT
ACATCTATCTTTCTTCTATTTGATACGACACTTATATATAATTGTATGAGAATTGCGTCATAACTATTCTAACTAATGTCATATCAATTACTCAATGCCG
CATGGATTCTATGCTTAGCTAACATACTCGTGTCAGCACAGATAAAGTCGGGACAACACATACGACAAAGAACTGCGAATCGCCACATGTACTACATATC
GCGATTATCTATGCCTACACCTCTCTTTCTTCTACTCTCTCTCGCCTCATGCACACACGCGCTCTTTGACGTCCCTTTCAAATAGACTATTACTCTGATT
AATATACATCTCATCTGGTAAGACTAAGATCTTACTTAGTATCTATATCTCGTCTATGCTGATTCTGAGATCTGTATTCAAGAATN
>LE_HBa0031F23_T7_139666 (trimmed for quality and cloning vector)
A

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031F23
Clone
Clone name
hba-31f23
LE_HBa0031F23
C02HBa0031F23
P031F23
Clone type
BAC
Contamination
none
Estimated length
112,628
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found