Clone Read LE_HBa0031F24_SP6_139667

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031F24_SP6_139667
Primer
SP6
ID from Seq. Facility
LE_HBa_031_F24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
569 trimmed for vector and quality, 889 raw
Genbank Accession
Sequence
>LE_HBa0031F24_SP6_139667 (raw untrimmed)
GGGAAATGAAGCCTGCATCCTAAACCAGTTTCGGTAATATTACGAGCATGAACTGGACCCCCTTCTGGTCTGCCTTGTATTATAGGATTTGCAACTTGGA
CCTTTATGTGCTACTATATGAAAGTTAACCTCAGATGTTTCTGCACAGTCGTTGCAAAGAATCCAAACCTAAAACTCAACGAAATTCAAATGTAAGGCAA
AAGGCGATCAAATTCATGTACGAAATTACAAATGGATCGATAAACGTGCTCCTTACCTTCTTGTCCTGATACATTTCAGGCATAGCTGTTGATGCAACCT
AGAATTAGAAAATAGACGAAACTTGTCAGTTTGAAGATAAGAGTCGGGAAAAAAAGTGTCAATCATCTTAGTAACTACTCCCTCAGTTTCAATTTGTTTG
TCTTACTTTCCTTTTTAGTCTGTTTAAGAAAGAATACAACTTTTCAGTTCTAACTTTCCACACGACACGTTTAAAACATTAAAGGTCATTTTGGTACATT
CTACGTATCTTTAGCTTAAGATCAGAAGATCCAAATGCCTTTTTTATTTTCGTAAGCTCCGTGTCTAGGAAATTAGAGACAAACAAATTGAAATGCAGGG
AGTGTATAGTGTGTACCTCCTGGTCCAGCTAGCTCCCAGACTCGAGACATGTCACAGTATGATTTTGAGCAAACAGGACAAGAATACCTGCATGCACAAA
TTATTGGAACCGAGCACAATGCAACCAAAGTCTATGTTGCTCGGATCATCCAAAAATGCATAGCTTTTTGAAGGATCCGACCAACAAACAGGCGAAATTT
TTAAGACTCTGAAGCACATAAACAAACGGGGAAGGGGGGTCCGTTATGGGGTCTTTAAGGAATGATTGTTTAAATAAGCCAATCACCTA
>LE_HBa0031F24_SP6_139667 (trimmed for quality and cloning vector)
ATGAACTGGACCCCCTTCTGGTCTGCCTTGTATTATAGGATTTGCAACTTGGACCTTTATGTGCTACTATATGAAAGTTAACCTCAGATGTTTCTGCACA
GTCGTTGCAAAGAATCCAAACCTAAAACTCAACGAAATTCAAATGTAAGGCAAAAGGCGATCAAATTCATGTACGAAATTACAAATGGATCGATAAACGT
GCTCCTTACCTTCTTGTCCTGATACATTTCAGGCATAGCTGTTGATGCAACCTAGAATTAGAAAATAGACGAAACTTGTCAGTTTGAAGATAAGAGTCGG
GAAAAAAAGTGTCAATCATCTTAGTAACTACTCCCTCAGTTTCAATTTGTTTGTCTTACTTTCCTTTTTAGTCTGTTTAAGAAAGAATACAACTTTTCAG
TTCTAACTTTCCACACGACACGTTTAAAACATTAAAGGTCATTTTGGTACATTCTACGTATCTTTAGCTTAAGATCAGAAGATCCAAATGCCTTTTTTAT
TTTCGTAAGCTCCGTGTCTAGGAAATTAGAGACAAACAAATTGAAATGCAGGGAGTGTATAGTGTGTAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963817
Expected error %
0.3973
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g22920.1 Score 65 E Value 1e-11 Identity 67.50% Align. Length 249bp (43.76%) Frame 3
68418.m02680 zinc finger (C3HC4-type RING finger) family protein contains Pfam profiles:PF05495 CHY zinc finger, PF00097 zinc finger, C3HC4 type (RING finger)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD02556.1| Score 76 E Value 5e-15 Identity 85.00% Align. Length 249bp (43.76%) Frame 3
PGPD14 [Petunia x hybrida]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031F24
Clone
Clone name
hba-31f24
LE_HBa0031F24
P031F24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found