Clone Read LE_HBa0031N15_T7_140034

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031N15_T7_140034
Primer
T7
ID from Seq. Facility
LE_HBa_031_N15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
729 trimmed for vector and quality, 952 raw
Genbank Accession
Sequence
>LE_HBa0031N15_T7_140034 (raw untrimmed)
ACTATCCGGGCCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGAAGTTGACTCTCTCAAGATTTATTTGTCCTCATATGTTTGAGTAC
ATGAACTATGTTTCTTTTAGTTTCTTTCATATAATACATTGTTTAAGACTTAGTATGTTTCTTTTAATGTAAAGGGTCGTGACCCTATGATATTAAGACG
TGTCTAAGATGGCTTGAGATGCATTTTGCCATTTTTGTATATTTTTTTCTTATGAATCATTGAACCTCCTGAGCAAACAAAGGAGGAAGAGAGGTAGAAA
AAACACAAATGAACAAAGAAACACGACAAAATTGTGTTATCTCTATTTATTATAAAGAACCCACAAATGACTTAGTTGATTAGATATGATGGATTTTTAT
ATTATTTTAGGCATAGACTAGTTTTGTGCTTGTTATGCCTACGGCGAATATAGAACTCAAAATGGTCAAGTTTTATTTTCTTAGTGGTCTAGCCTTAGAG
TGGAAACGTAATATAGAAGTGCCTGAGGTTTGATATTCTTATACCTTAAGGCTAGAAAATTAAGTCTCTAAGGGCTGAAATTTTTTTGTCTCTCTTTGTT
CCTTTGTGTATTTTCTACCTCTATTCCTCTTAAGTTTTTTTAGGAGGTTCAATGGTTCACTAGAATTTTTTTTTTATTAAAATAACCAAATTAATCTCAA
TTTATTCTTGTACACAACTAATATCCAAAGTATCCCTTCTAAAAAAATGACTGAATGTTTATCACATTCCCGAAAGTAGTATTTGGGATCTTCTGTGTCA
TTTCCTAACTCTTGTTGTGGTTTCCCAAAATATTAGGAACCAATTTTCCTCCCTCAGAATCTAGCCCTAATTTAAACATGTCTTTTTTAGACATGCTTAT
AATCCTTGTTTTGATTTTCGCTAAATTTTATTGTGAAAAATTTTTCCCTTCT
>LE_HBa0031N15_T7_140034 (trimmed for quality and cloning vector)
AGCTTGAGAAGTTGACTCTCTCAAGATTTATTTGTCCTCATATGTTTGAGTACATGAACTATGTTTCTTTTAGTTTCTTTCATATAATACATTGTTTAAG
ACTTAGTATGTTTCTTTTAATGTAAAGGGTCGTGACCCTATGATATTAAGACGTGTCTAAGATGGCTTGAGATGCATTTTGCCATTTTTGTATATTTTTT
TCTTATGAATCATTGAACCTCCTGAGCAAACAAAGGAGGAAGAGAGGTAGAAAAAACACAAATGAACAAAGAAACACGACAAAATTGTGTTATCTCTATT
TATTATAAAGAACCCACAAATGACTTAGTTGATTAGATATGATGGATTTTTATATTATTTTAGGCATAGACTAGTTTTGTGCTTGTTATGCCTACGGCGA
ATATAGAACTCAAAATGGTCAAGTTTTATTTTCTTAGTGGTCTAGCCTTAGAGTGGAAACGTAATATAGAAGTGCCTGAGGTTTGATATTCTTATACCTT
AAGGCTAGAAAATTAAGTCTCTAAGGGCTGAAATTTTTTTGTCTCTCTTTGTTCCTTTGTGTATTTTCTACCTCTATTCCTCTTAAGTTTTTTTAGGAGG
TTCAATGGTTCACTAGAATTTTTTTTTTATTAAAATAACCAAATTAATCTCAATTTATTCTTGTACACAACTAATATCCAAAGTATCCCTTCTAAAAAAA
TGACTGAATGTTTATCACATTCCCGAAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.93022
Expected error %
0.6281
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031N15
Clone
Clone name
hba-31n15
LE_HBa0031N15
P031N15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found