Clone Read LE_HBa0031P17_SP6_140133

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0031P17_SP6_140133
Primer
SP6
ID from Seq. Facility
LE_HBa_031_P17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
720 trimmed for vector and quality, 922 raw
Genbank Accession
Sequence
>LE_HBa0031P17_SP6_140133 (raw untrimmed)
AACGCACTCGAGGATAGATAGTATTGCGGCGAACAGTATACATGTTATCTAACATGGGTGATCATATACACCCACATGGTTGGCTTGAGTGGAATGGTGA
TTTTGCGCTGAACACATTGTATTATGGTGAATACATGAACTTTGGGCCAGGAGCAGCAGTAGGGCAACGCGTCACTTGGCCAGGGTATCGGGTGATTAAG
TCTGTCGAAGAGGCCAGCAAGTTCACTGTATCAAAGTTTATTTATGGATCATCTTGGTTGCCTTCAACTGGGGTGTCTTTCTTGGCAGGGCTAAGTACTT
AAAAGAAAGGTATAAATATCAGATTTATGTCTTTTTGCAGTCGGTATATATAAATAATAAGTATGTACCATTGTTATTTAATTCTTAAGTGTAATAATTT
ATAAGCTGTAAGTTGCAATTTTGCTTTATTGGTGAACTGACTAAAGAGCAAGTTTGCAACATTCTAGAGATACCTCTTCATTAAATGATAAATGTTGTAA
TTTCTTTTTTTGTTGTAATTAGAACATACTAGCAAAAAGTTATTGGTTTAATTGAAAAGTGCCAGTTTCACATTACATTCAATTGACTTTTGTGGATGTG
TATCTCCTTTAATAACCAGGTACAGAATCGTCTTTGATATGGAGTGTTTTACTCAAAGTGAGACTTTTCGATAGTCAGGCCCAAAGCAAGCACAGGAAGA
AGGGTGGAAAAACAGAAAAATCATACGCACTTGGACTTGTGCAGAAGTCAGAAGCTTAGCAAAATGGTTTCCTATTAATATAATTTTGATCAATCCTTTT
CTTTCCATTGAAATTTGATTAGATAAGGAATGTGATGCTGACAGAGAACCAAACCAATTTACTGGTGGTTAGTTTTCTGAATTTAAATAAACACTTAAAA
TGTTAGGGGTCCCCCCAGGCAA
>LE_HBa0031P17_SP6_140133 (trimmed for quality and cloning vector)
CGAACAGTATACATGTTATCTAACATGGGTGATCATATACACCCACATGGTTGGCTTGAGTGGAATGGTGATTTTGCGCTGAACACATTGTATTATGGTG
AATACATGAACTTTGGGCCAGGAGCAGCAGTAGGGCAACGCGTCACTTGGCCAGGGTATCGGGTGATTAAGTCTGTCGAAGAGGCCAGCAAGTTCACTGT
ATCAAAGTTTATTTATGGATCATCTTGGTTGCCTTCAACTGGGGTGTCTTTCTTGGCAGGGCTAAGTACTTAAAAGAAAGGTATAAATATCAGATTTATG
TCTTTTTGCAGTCGGTATATATAAATAATAAGTATGTACCATTGTTATTTAATTCTTAAGTGTAATAATTTATAAGCTGTAAGTTGCAATTTTGCTTTAT
TGGTGAACTGACTAAAGAGCAAGTTTGCAACATTCTAGAGATACCTCTTCATTAAATGATAAATGTTGTAATTTCTTTTTTTGTTGTAATTAGAACATAC
TAGCAAAAAGTTATTGGTTTAATTGAAAAGTGCCAGTTTCACATTACATTCAATTGACTTTTGTGGATGTGTATCTCCTTTAATAACCAGGTACAGAATC
GTCTTTGATATGGAGTGTTTTACTCAAAGTGAGACTTTTCGATAGTCAGGCCCAAAGCAAGCACAGGAAGAAGGGTGGAAAAACAGAAAAATCATACGCA
CTTGGACTTGTGCAGAAGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963713
Expected error %
0.1059
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g49220.1 Score 150 E Value 9e-37 Identity 24.70% Align. Length 266bp (36.94%) Frame 2
68416.m05379 pectinesterase family protein contains Pfam profile: PF01095 pectinesterase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g53370.1 Score 145 E Value 2e-35 Identity 24.70% Align. Length 266bp (36.94%) Frame 2
68418.m06632 pectinesterase family protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE76634.1| Score 158 E Value 1e-37 Identity 25.90% Align. Length 269bp (37.36%) Frame 2
pectin methylesterase [Cicer arietinum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ21127.1| Score 155 E Value 1e-36 Identity 25.80% Align. Length 266bp (36.94%) Frame 2
pectinesterase [Fragaria x ananassa]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0031P17
Clone
Clone name
hba-31p17
LE_HBa0031P17
C03HBa0031P17
P031P17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found