Clone Read LE_HBa0032A24_T7_140196

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032A24_T7_140196
Primer
T7
ID from Seq. Facility
LE_HBa_032_A24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
633 trimmed for vector and quality, 814 raw
Genbank Accession
Sequence
>LE_HBa0032A24_T7_140196 (raw untrimmed)
TTTTGGACCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTTTGTAGTGAAGACATCCCATTTTGGGGAGCTCTTCAGGAATCTCCAGA
CCACAATCTGCCTTTTTGGGGGAAAAGAAAAGTAAGTTAGAATACACAGATTCACCTATTGATAAGCAGTACTGTTCTATGATTCAAAAAAAGTGTTTAC
GCAGAAGACTAAACCCACACATAAAACATTTGATGACTGCCCTAACATATAAAGAAACAGGAAACACATAAGATCAGCAAGAACCTTTAAAAGAGGGTTT
ATGATGTAAAGAAGGAAAACCATAGTTTAGTATCTTTTTTCATTCTAGGACCATCAGAGGCATGGTAGACTACTAAAGCAAATAAAACTTCCATATTCTT
TTAACCTGCGGCAAGGGAAGCACAGCAAGAAAATCGATGATAAAATAGAATCGCAAGTATCTTTTAGCAATCTGTGCAGGATCTATCACAAGTTCACCCC
GTCCAAAAACTCGAGATGACGGTGCAATATAAGCTGTGCGGAACTGAAGAGCCATGTGAATAAGATAGAAAGCATCAATCACTGTACGTAGGGTAGTGGC
TATGACAGCTAGCTTCCTATCGATCTGAAGGCAATTTGACTTGTTATCAAAAACCTGGAAGGTAGAAAAACAGTGGGTCCTCGGATACGGCTAGAATACA
TGATACAACAAAAAGTTTGGTTCCTTAAACAGAAGGGATTTTATCTTGGGGGGGTAAAAATCTTTCTTCTTCTGAAACTTTTGAAATCTTCCCGGAAATA
CAGCCCCGAGAGAC
>LE_HBa0032A24_T7_140196 (trimmed for quality and cloning vector)
AGCTTGCTTTGTAGTGAAGACATCCCATTTTGGGGAGCTCTTCAGGAATCTCCAGACCACAATCTGCCTTTTTGGGGGAAAAGAAAAGTAAGTTAGAATA
CACAGATTCACCTATTGATAAGCAGTACTGTTCTATGATTCAAAAAAAGTGTTTACGCAGAAGACTAAACCCACACATAAAACATTTGATGACTGCCCTA
ACATATAAAGAAACAGGAAACACATAAGATCAGCAAGAACCTTTAAAAGAGGGTTTATGATGTAAAGAAGGAAAACCATAGTTTAGTATCTTTTTTCATT
CTAGGACCATCAGAGGCATGGTAGACTACTAAAGCAAATAAAACTTCCATATTCTTTTAACCTGCGGCAAGGGAAGCACAGCAAGAAAATCGATGATAAA
ATAGAATCGCAAGTATCTTTTAGCAATCTGTGCAGGATCTATCACAAGTTCACCCCGTCCAAAAACTCGAGATGACGGTGCAATATAAGCTGTGCGGAAC
TGAAGAGCCATGTGAATAAGATAGAAAGCATCAATCACTGTACGTAGGGTAGTGGCTATGACAGCTAGCTTCCTATCGATCTGAAGGCAATTTGACTTGT
TATCAAAAACCTGGAAGGTAGAAAAACAGTGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962626
Expected error %
0.8937
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g30560.1 Score 140 E Value 4e-34 Identity 26.30% Align. Length 269bp (42.50%) Frame 3
68417.m04337 cyclic nucleotide-regulated ion channel, putative similar to cyclic nucleotide and calmodulin-regulated ion channel cngc6 GI:4581207 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g19780.1 Score 139 E Value 1e-33 Identity 24.20% Align. Length 284bp (44.87%) Frame 3
68414.m02473 cyclic nucleotide-regulated ion channel, putative (CNGC8) similar to cyclic nucleotide and calmodulin-regulated ion channel GI:4581207 from (Arabidopsis thaliana)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79774.1| Score 140 E Value 2e-32 Identity 26.30% Align. Length 269bp (42.50%) Frame 3
cyclic nucleotide and calmodulin-regulated ion channel-like protein [Arabidopsis thaliana] ref|NP_194785.1| cyclic nucleotide-regulated ion channel, putative [Arabidopsis thaliana] sp|Q9M0A4|CNGC9_ARATH Putative cyclic nucleotide-gated ion channel 9 (Cyclic nucleotide- and calmodulin-regulated ion channel 9)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG12561.1| Score 139 E Value 6e-32 Identity 24.20% Align. Length 284bp (44.87%) Frame 3
Putative cyclic nucleotide and calmodulin-regulated ion channel [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032A24
Clone
Clone name
hba-32a24
LE_HBa0032A24
P032A24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found