Clone Read LE_HBa0032F01_SP6_140389

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032F01_SP6_140389
Primer
SP6
ID from Seq. Facility
LE_HBa_032_F01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
434 trimmed for vector and quality, 865 raw
Genbank Accession
Sequence
>LE_HBa0032F01_SP6_140389 (raw untrimmed)
TTTTTATTTTTTGCAATTTTATTGTTTCATCTTGTACACCAAGTCATCCCTTGAGTAGTCATCAATTATGGACACAAAAAATCTGCAGCCTCCCAAAGAC
TCAACACGGCATGGACCCCAGCAATCAGAATGGATATAATCAAGTGTGCCTTTTGTTCTGTGAATGGCCTTTGGAAACTTGTTGCGATGTAGTCTTCCAA
AGACACAATGTTCACAAAACTCTAGGCTCTTAACCTTATGACCAGCAAGAAGATCCTTCTTTGACAGAATTTGCATCCCTCTTTCACCCATATGACCAAG
TCTCATGTGCCATAACTTAGTCATATCCTCCTGGTGAACTTCTGACGATGCAACATGGGTTGAACCTGTAACCGTGGAACCTTGTAGAAAATACAAAGTA
CCACGCATGACACCTTTCAAAATCAGATTTGAACCCTTCCAGACCCGCAAGACTCCATCTTTTCCCGACCAGCTGAATCCCTTGCTGTCCAAAAGACTGA
GAGATATCAGATTTCTCGTCATCAATGGAACGTGCCCGACCTCTTTCAATGTGCAGAAGCTACCATCATGTGTCCTTATCCTGATCAAGCCTGTCCCAAC
CACCTTGCATATTCAACTATTGGTCTTCGAGATGCTGCCTCTGTCTACCCTACTCATAAGTCGTGAACCACTTCTCTCTAGGATATATGTGATAGGATTT
CTTAAAATTTTTAACCCTCATCTTCTTAATGAAGATGTGTCCCCCTTCTCTAACTTACAGCTTGTCTTCCTTCACAATATGTTCTCCTCTTTAACCAATT
TCTTATGAAAATTTTCTGTTATTCACTCTTCTTTCTTCTCTTTTTGTACTATTATAATTTTTCTT
>LE_HBa0032F01_SP6_140389 (trimmed for quality and cloning vector)
GTCATCAATTATGGACACAAAAAATCTGCAGCCTCCCAAAGACTCAACACGGCATGGACCCCAGCAATCAGAATGGATATAATCAAGTGTGCCTTTTGTT
CTGTGAATGGCCTTTGGAAACTTGTTGCGATGTAGTCTTCCAAAGACACAATGTTCACAAAACTCTAGGCTCTTAACCTTATGACCAGCAAGAAGATCCT
TCTTTGACAGAATTTGCATCCCTCTTTCACCCATATGACCAAGTCTCATGTGCCATAACTTAGTCATATCCTCCTGGTGAACTTCTGACGATGCAACATG
GGTTGAACCTGTAACCGTGGAACCTTGTAGAAAATACAAAGTACCACGCATGACACCTTTCAAAATCAGATTTGAACCCTTCCAGACCCGCAAGACTCCA
TCTTTTCCCGACCAGCTGAATCCCTTGCTGTCCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95749
Expected error %
0.2386
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_474090.1| Score 157 E Value 7e-38 Identity 16.40% Align. Length 431bp (99.31%) Frame 2
OSJNBa0033G05.13 [Oryza sativa (japonica cultivar-group)] emb|CAD41912.2| OSJNBa0033G05.13 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD40363.2| Score 155 E Value 3e-37 Identity 16.20% Align. Length 431bp (99.31%) Frame 2
OSJNBa0093P23.9 [Oryza sativa (japonica cultivar-group)] ref|XP_471675.1| OSJNBa0093P23.9 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032F01
Clone
Clone name
hba-32f1
LE_HBa0032F01
C06HBa0032F01
P032F01
Clone type
BAC
Contamination
none
Estimated length
162,846
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found