Clone Read LE_HBa0032F01_T7_140390

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032F01_T7_140390
Primer
T7
ID from Seq. Facility
LE_HBa_032_F01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
491 trimmed for vector and quality, 857 raw
Genbank Accession
Sequence
>LE_HBa0032F01_T7_140390 (raw untrimmed)
TAATATCTGGTCCCCCGGGTGTATCCTCTTATAGTCGACCTGCAGGCATGCAAGCTTCATCAAGCAAGGAGTCTATGTAAACTCCACATATGATACATGA
GAGGTCTATGCATAGGTCACAATGAAATAGTTTTAAAGTTTCCGCATTTTTTACTTATGATATGTAATGTTGAATGCTAAGGTCTAGTCTAAGTCCTCTT
CGAGGACGAAGACGCCGGTCATGTCTAAGGGGTGTTCTCCGGTCGTGATTGTTCAGCTTTCTTGGAACATCTAAGGGAGGACACTTTCAAAGTGTCTTCT
ATCAAGTCTGTTTTGAGATTTCATGAGTTTATGGATTTATTCATGTATACCTACCTGGTATGCCAATTTATAGGAATATTGATTTTTTTATTGAACTAAA
GCCATGGACTCGCCCCATTTCCATTCCTCTTATTGAATGGCCTCAGCTGAGTTGAGAGAGTTCAAGGCCCATCTTCTTGAGTTCTTCGGTAAAGGTTTTA
TTAGACCGACTGCCTCTCATTGGGGTTATCTAGTTCTATTTGTGAAGAAAAAGGATGTTAGTTTTCATATGTGCATAGACTACGGGAAGTTGAATAACGT
GACTATTAAGAAAAAGTAACCATTTCTTAATTTCCTGGTTTGATCACTTACGACGTGTTTGAGGGTTCCTAACATTGATATGAGGTTCGTGTTATCATCA
TTTATATAGATGTGCAACAATAGTGCCCATAGACTCCTTTTCGCTTTAGGTGAGGACTTTTTTGATTTCCTTGTGATTTTCTCTTGGTGTTCCCTCTCTC
CCCGTTTCTTATTCTCTGACCTCTGCTGGATATGTAACATTTATAGCACTGATCTTG
>LE_HBa0032F01_T7_140390 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTCATCAAGCAAGGAGTCTATGTAAACTCCACATATGATACATGAGAGGTCTATGCATAGGTCACAATGAAATAGTTTTAAA
GTTTCCGCATTTTTTACTTATGATATGTAATGTTGAATGCTAAGGTCTAGTCTAAGTCCTCTTCGAGGACGAAGACGCCGGTCATGTCTAAGGGGTGTTC
TCCGGTCGTGATTGTTCAGCTTTCTTGGAACATCTAAGGGAGGACACTTTCAAAGTGTCTTCTATCAAGTCTGTTTTGAGATTTCATGAGTTTATGGATT
TATTCATGTATACCTACCTGGTATGCCAATTTATAGGAATATTGATTTTTTTATTGAACTAAAGCCATGGACTCGCCCCATTTCCATTCCTCTTATTGAA
TGGCCTCAGCTGAGTTGAGAGAGTTCAAGGCCCATCTTCTTGAGTTCTTCGGTAAAGGTTTTATTAGACCGACTGCCTCTCATTGGGGTTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967721
Expected error %
0.6245
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032F01
Clone
Clone name
hba-32f1
LE_HBa0032F01
C06HBa0032F01
P032F01
Clone type
BAC
Contamination
none
Estimated length
162,846
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found