Clone Read LE_HBa0032F15_SP6_140417

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032F15_SP6_140417
Primer
SP6
ID from Seq. Facility
LE_HBa_032_F15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
577 trimmed for vector and quality, 841 raw
Genbank Accession
Sequence
>LE_HBa0032F15_SP6_140417 (raw untrimmed)
AGAATTTTGCCCTCTCATCATCTTCAACTAGAAATCTATTGTGTGAAAAATGAGGATTTTGTTTTGAAGTGAGGACACTAGTTGCAATACCGGAATCGTT
AGCACCTCGGTGAGAAATTGAAGAGGATAGGTGTTAGTGCATGGTGAGTCTGTGTCATGTTCTAATCCCACAAAATTCAAGCCTAATAGTGATAGCATGC
ATAGATTTGAGGAGATTAATCGGGATTGATAGCCAAAGGATAAAACATGAATACTATTGTACAAAGATTGTGTAGTAAGTCATAGTGCGCCACTTGAGGT
CAAACAACGAATTTAAGTTGAGGGTGTTGATATACCGTGGTTTCACGGTATAATTAATACTTTTTCCTTAAGTTTAGTGTGTCCGAAAGTCTTTTTGTGC
TAGTTTTTATATGAGTTTGTTTTTGTTTTGCAGGAATTTTGTCCAAAGTTGAATGCGGAGATTTTGAGTGAAGAAATGCAGAAGAGACCACCTACGGAGC
AGATGACGGTCTGTCGTGCTTGTGACGGTCCGTAGGTGGCAGCGTAGAGAAGCTGCTGAAGGAACATGGGGAAGTGTTTTGAAATGAAGACCCTTGACGG
ACCGTTGTGCCTATGACGGGTCTGTCATACTTGCCGTTGAGGGGAATGAAGAAAGCAGCAGATAAAATTTCTATGTATGAGACGATGGAGTCCACGACGG
TCCGTCGCGAGGTTCGTCAACCCACTTGCTTTTTGCAGAATTCCAGCCATATGAATCCTTGTTAATTAGGTTTTTTTTTTTTTTTAAATAGTTTAAAAAC
CCCCGTTTTAAGGTTTAACCTAGGTAAATTTAAACTCAATG
>LE_HBa0032F15_SP6_140417 (trimmed for quality and cloning vector)
ATTGTGTGAAAAATGAGGATTTTGTTTTGAAGTGAGGACACTAGTTGCAATACCGGAATCGTTAGCACCTCGGTGAGAAATTGAAGAGGATAGGTGTTAG
TGCATGGTGAGTCTGTGTCATGTTCTAATCCCACAAAATTCAAGCCTAATAGTGATAGCATGCATAGATTTGAGGAGATTAATCGGGATTGATAGCCAAA
GGATAAAACATGAATACTATTGTACAAAGATTGTGTAGTAAGTCATAGTGCGCCACTTGAGGTCAAACAACGAATTTAAGTTGAGGGTGTTGATATACCG
TGGTTTCACGGTATAATTAATACTTTTTCCTTAAGTTTAGTGTGTCCGAAAGTCTTTTTGTGCTAGTTTTTATATGAGTTTGTTTTTGTTTTGCAGGAAT
TTTGTCCAAAGTTGAATGCGGAGATTTTGAGTGAAGAAATGCAGAAGAGACCACCTACGGAGCAGATGACGGTCTGTCGTGCTTGTGACGGTCCGTAGGT
GGCAGCGTAGAGAAGCTGCTGAAGGAACATGGGGAAGTGTTTTGAAATGAAGACCCTTGACGGACCGTTGTGCCTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951714
Expected error %
0.0736
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032F15
Clone
Clone name
hba-32f15
LE_HBa0032F15
P032F15
Clone type
BAC
Contamination
none
Estimated length
96,708
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found