Clone Read LE_HBa0032F15_T7_140418

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032F15_T7_140418
Primer
T7
ID from Seq. Facility
LE_HBa_032_F15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
617 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0032F15_T7_140418 (raw untrimmed)
CCTGGCCCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTAGCAGCGCAAAGTAGACAAAAAGAATATGCAGATCGAAAGGTTAGAGAG
TTAGAGTTCATGGAGGGTGAACAAGTCTTGTTGAAAGTTTCACCAATGAAAGGGGTGATGCGGTTTGGTAAAAGGGGTAAACTAAGTCCAAGGTACATTG
GACCATTTGAAGTACTTAAGCGAGTAGGAGAGGTGGCTTATGAGTTAGCCTTGCCTTCAGGGCTGTCCGGAGTACATCCGGTATTCCATGTGTCGATGTT
GAAAAGATACCATGGGGATTGAAACTACATTATCAGTTGGGATTCAGTTTTGCTTGATGAGAACTTGTTTTATGAGGAGGAGCCTGTTGCTATTTTAGAT
AGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATCAAAGTGCAATGGAAGAATCGACCTGTTGAAGAAGCCACTTGGGAGAAGGAGGCGGATA
TGCGAGAAAAATACCCACATCTGTTTACAGATTCAGGTACTCCTTTTCACCCTTGTTTTCCTTCTTTTGATCGTTCGGGGACGAACGATGGGTAAATTGG
TATCTATTATAACGACCTGTTTAGTCCGTTTTTGAGCAGTAGATTTTATTTTTGGAAAAAAAGGGTGAGGCGACGAACCCAACTACGGAACGTCCTGGGC
ACTACGGACCGGCCCAGGGGCTTCTTTTCAAAACAACTTAAAAAATCTGAAAATTGGGTACTGAAAATCTACTCCTCTTAATTTTTTTCCGGAAAGGGAA
GGAAGGACCCTCCCATGGTTTAACAGGACCCTCCACCTGTGTTAACGGAATCTTTACAAGCGTGTCATGGGATCTTTTTCATCGGTTATTGGTTAATCCG
TTCTATAAGCTT
>LE_HBa0032F15_T7_140418 (trimmed for quality and cloning vector)
AGCTTCTAGCAGCGCAAAGTAGACAAAAAGAATATGCAGATCGAAAGGTTAGAGAGTTAGAGTTCATGGAGGGTGAACAAGTCTTGTTGAAAGTTTCACC
AATGAAAGGGGTGATGCGGTTTGGTAAAAGGGGTAAACTAAGTCCAAGGTACATTGGACCATTTGAAGTACTTAAGCGAGTAGGAGAGGTGGCTTATGAG
TTAGCCTTGCCTTCAGGGCTGTCCGGAGTACATCCGGTATTCCATGTGTCGATGTTGAAAAGATACCATGGGGATTGAAACTACATTATCAGTTGGGATT
CAGTTTTGCTTGATGAGAACTTGTTTTATGAGGAGGAGCCTGTTGCTATTTTAGATAGAGAAGTTCGCAAGTTGAGGTCAAGAGAGATTGCATCCATCAA
AGTGCAATGGAAGAATCGACCTGTTGAAGAAGCCACTTGGGAGAAGGAGGCGGATATGCGAGAAAAATACCCACATCTGTTTACAGATTCAGGTACTCCT
TTTCACCCTTGTTTTCCTTCTTTTGATCGTTCGGGGACGAACGATGGGTAAATTGGTATCTATTATAACGACCTGTTTAGTCCGTTTTTGAGCAGTAGAT
TTTATTTTTGGAAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957565
Expected error %
0.4057
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 218 E Value 9e-56 Identity 21.20% Align. Length 494bp (80.06%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 211 E Value 8e-54 Identity 20.80% Align. Length 494bp (80.06%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032F15
Clone
Clone name
hba-32f15
LE_HBa0032F15
P032F15
Clone type
BAC
Contamination
none
Estimated length
96,708
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found